From AureoWiki
Jump to: navigation, search
NCBI: 06-JUL-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_1766 [new locus tag: NWMN_RS10100 ]
  • pan locus tag?: SAUPAN004857000
  • symbol: NWMN_1766
  • pan gene symbol?: sgtB
  • synonym:
  • product: glycosyltransferase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_1766 [new locus tag: NWMN_RS10100 ]
  • symbol: NWMN_1766
  • product: glycosyltransferase
  • replicon: chromosome
  • strand: -
  • coordinates: 1977903..1978712
  • length: 810
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    ATGAAAAGAAGCGATAGGTACTCAAACTCAAATGAACATTTTGAGCATATGAAACACGAA
    CCTCACTATAATACGTATTATCAACCAGTTGGCAAACCGCCGAAAAAGAAAAAAAGTAAA
    CGAATACTATTAAAAATATTATTAACCATTCTAATCATTATCGCATTGTTTATTGGTATC
    ATGTATTTTTTATCTACACGCGATAATGTGGATGAACTAAGAAAAATTGAAAATAAAAGT
    AGTTTTGTGTCAGCTGATAACATGCCAGAGTATGTTAAAGGTGCCTTTATTTCAATGGAA
    GATGAACGATTCTACAATCATCATGGATTCGATTTGAAAGGTACAACTAGAGCTTTATTT
    TCAACGATTAGCGACAGAGATGTGCAAGGTGGTAGTACCATTACACAACAAGTTGTCAAA
    AATTATTTTTATGATAATGATCGTTCATTTACTAGAAAAGTAAAAGAATTATTTGTAGCT
    CATCGAGTTGAAAAACAATATAATAAGAACGAAATTTTAAGCTTTTATTTAAATAATATT
    TACTTTGGGGATAATCAATATACGCTTGAGGGCGCAGCAAACCATTACTTTGGAACAACC
    GTGAATAAAAATAGTACAACAATGTCTCACATAACAGTTTTACAAAGCGCTATTTTAGCT
    AGTAAAGTCAATGCACCTAGCGTATATAATATCAATAATATGTCAGAGAATTTTACGCAA
    CGTGTAAGCACGAACTTAGAAAAAATGAAGCAACAAAATTATATCAATGAAACACAATAT
    CAACAGGCTATGTCACAATTAAATCGTTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    810

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_1766 [new locus tag: NWMN_RS10100 ]
  • symbol: NWMN_1766
  • description: glycosyltransferase
  • length: 269
  • theoretical pI: 9.82726
  • theoretical MW: 31459.4
  • GRAVY: -0.664312

Function[edit source | edit]

  • reaction:
    EC 2.4.-.-?  ExPASy
  • TIGRFAM:
    Cell structureCell envelopeBiosynthesis and degradation of murein sacculus and peptidoglycanpenicillin-binding protein, 1A family (TIGR02074; HMM-score: 199.4)
    Cell structureCell envelopeBiosynthesis and degradation of murein sacculus and peptidoglycanpenicillin-binding protein 1B (TIGR02071; HMM-score: 131.8)
    Cell structureCell envelopeBiosynthesis and degradation of murein sacculus and peptidoglycanmonofunctional biosynthetic peptidoglycan transglycosylase (TIGR02070; EC 2.4.2.-; HMM-score: 127.2)
    Cell structureCell envelopeBiosynthesis and degradation of murein sacculus and peptidoglycanpenicillin-binding protein 1C (TIGR02073; HMM-score: 114.3)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesoligosaccharide repeat unit polymerase (TIGR04370; HMM-score: 14.2)
    YhgE/Pip N-terminal domain (TIGR03061; HMM-score: 13.3)
  • TheSEED:  
    CBSS-176280.1.peg.1561 Monofunctional biosynthetic peptidoglycan transglycosylase 
    Peptidoglycan Biosynthesis Monofunctional biosynthetic peptidoglycan transglycosylase 
  • PFAM:
    Lysozyme (CL0037) Transgly; Transglycosylase (PF00912; HMM-score: 186.5)
    no clan definedOrf78; Orf78 (ac78) (PF06024; HMM-score: 18.6)
    Sigma_reg_N; Sigma factor regulator N-terminal (PF13800; HMM-score: 9.2)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 10
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helix: 1
  • LocateP: N-terminally anchored (No CS)
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular Possibility: 0.17
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 7
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.129
    • Ymax_pos: 47
    • Cmax: 0.104
    • Cmax_pos: 38
    • Smax: 0.213
    • Smax_pos: 39
    • Smean: 0.12
    • D: 0.126
  • predicted transmembrane helices (TMHMM): 1

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MKRSDRYSNSNEHFEHMKHEPHYNTYYQPVGKPPKKKKSKRILLKILLTILIIIALFIGIMYFLSTRDNVDELRKIENKSSFVSADNMPEYVKGAFISMEDERFYNHHGFDLKGTTRALFSTISDRDVQGGSTITQQVVKNYFYDNDRSFTRKVKELFVAHRVEKQYNKNEILSFYLNNIYFGDNQYTLEGAANHYFGTTVNKNSTTMSHITVLQSAILASKVNAPSVYNINNMSENFTQRVSTNLEKMKQQNYINETQYQQAMSQLNR

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]