From AureoWiki
Jump to: navigation, search
Pangenome04-0298108BA0217611819-9771193COLECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50N315NCTC8325NewmanRF122ST398T0131TCH60TW20USA300_FPR3757USA300_TCH1516VC40
NCBI: 06-JUL-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_1872 [new locus tag: NWMN_RS10770 ]
  • pan locus tag?: SAUPAN005009000
  • symbol: map
  • pan gene symbol?: eap/map
  • synonym:
  • product: MHC class II analog protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_1872 [new locus tag: NWMN_RS10770 ]
  • symbol: map
  • product: MHC class II analog protein
  • replicon: chromosome
  • strand: -
  • coordinates: 2085907..2087661
  • length: 1755
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    ATGAAATTTAAGTCATTGATTACAACAACTTTAGCATTAGGTGTTTTAGCATCAACAGGT
    GCAAACTTTAATAATAATGAAGCGTCTGCCGCAGCTAAGCCATTAGATAAATCATCAAGT
    TCGTTACACCATGGATATTCTAAAGTCCATGTTCCATATGCAATCACTGTGAACGGTACA
    AGCCAAAATATTTTATCAAGCTTAACATTTAATAAGAATCAAAATATTAGTTATAAAGAT
    TTAGAGGATAGAGTTAAATCAGTTTTAAAATCAGACAGAGGTATTAGTGATATAGATTTA
    AGACTATCGAAGCAAGCGAAATATACTGTTTACTTTAAAAATGGAACAAAGAAAGTTATC
    GATTTGAAAGCAGGTATTTACACAGCTGATTTAATTAATACAAGTGAAATTAAAGCTATT
    AATATTAACGTAGATACTAAAAAGCAAGTTGAAGATAAAAAGAAAGATAAAGCAAATTAC
    CAAGTTCCATACACAATCACTGTGAACGGTACAAGCCAAAATATTTTATCAAACTTAACA
    TTTAATAAGAATCAAAATATTAGTTACAAAGATTTAGAGGATAAAGTTAAATCAGTTTTA
    GAATCAAATAGAGGTATTACCGATGTTGATTTAAGATTATCGAAGCAAGCGAAATATACA
    GTTAATTTTAAAAATGGAACGAAGAAAGTTATCGATTTGAAATCAGGTATTTACACAGCG
    AATTTAATAAATTCAAGTGATATTAAAAGTATCAATATTAACGTAGATACAAAAAAACAT
    ATCGAAAATAAAGCTAAAAGAAACTATCAAGTTCCATATTCAATTAATTTAAATGGTACA
    TCTACAAACATTTTATCGAATCTTTCATTTTCAAATAAACCTTGGACAAATTACAAAAAT
    TTAACTAGTCAAATAAAATCAGTACTGAAGCATGATAGAGGTATTAGTGAACAAGATTTA
    AAATATGCTAAGAAAGCTTATTATACTGTTTATTTTAAAAATGGTGGTAAAAGAATCTTA
    CAGTTGAATTCAAAAAATTACACAGCAAACTTAGTTCATGCGAAAGATGTTAAGAGAATT
    GAAATTACTGTTAAAACAGGAACTAAAGCGAAAGCAGACAGATATGTACCATACACAATT
    GCAGTAAATGGCACATCAACACCAATTTTATCAGATTTAAAATTTACAGGTGACCCACGT
    GTAGGCTACAAAGATATCTCTAAAAAAGTTAAATCAGTATTGAAGCATGATAGAGGTATC
    GGGGAACGTGAATTAAAATATGCAAAAAAAGCAACTTACACAGTACATTTTAAAAATGGA
    ACGAAAAAAGTGATTAACATAAATTCAAATATTAGCCAACTGAATCTGCTTTATGTTCAA
    GATATTAAAAAGATAGATATTGATGTTAAAACAGGAACTAAAGCGAAAGCGGATAGCTAT
    GTACCATATACAATTGCAGTAAATGGCACATCAACACCAATTTTATCAAAACTTAAAATT
    TCGAATAAACAATTAATTAGTTACAAATATTTAAATGACAAAGTGAAATCTGTATTAAAA
    AGTGAAAGAGGCATCAGTGATCTTGACTTAAAATTTGCGAAACAAGCAAAATATACAGTA
    TATTTCAAAAATGGAAAGAAACAAGTAGTGAATTTAAAATCAGACATCTTTACACCTAAT
    TTATTTAGTGCCAAAGATATTAAAAAGATTGATATTGATGTAAAACAATACACTAAATCA
    AAAAAAAATAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1755

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_1872 [new locus tag: NWMN_RS10770 ]
  • symbol: Map
  • description: MHC class II analog protein
  • length: 584
  • theoretical pI: 10.5258
  • theoretical MW: 65573.8
  • GRAVY: -0.581678

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    modification target Cys-rich peptide, AC3_0185 family (TIGR04118; HMM-score: 13.7)
  • TheSEED:  
    Virulence, Disease and DefenseAdhesionAdhesins in Staphylococcus Extracellular adherence protein of broad specificity Eap/Map 
  • PFAM:
    Ant-toxin_C (CL0386) MAP; MAP domain (PF03642; HMM-score: 586)
    no clan definedDUF3553; Protein of unknown function (DUF3553) (PF12073; HMM-score: 21.8)
    Tudor (CL0049) LBR_tudor; Lamin-B receptor of TUDOR domain (PF09465; HMM-score: 20.6)
    no clan definedDUF4333; Domain of unknown function (DUF4333) (PF14230; HMM-score: 17.9)
    GAPES3; Gammaproteobacterial periplasmic sensor domain (PF17154; HMM-score: 13.6)
    Trefoil (CL0066) DUF569; Domain of unknown function (DUF569) (PF04601; HMM-score: 12.8)
    no clan definedRibosomal_S21e; Ribosomal protein S21e (PF01249; HMM-score: 9.2)
    Cupin (CL0029) VIT_2; Vault protein inter-alpha-trypsin domain (PF13757; HMM-score: 8.9)
    Homing_endonuc (CL0324) Hom_end; Homing endonuclease (PF05204; HMM-score: 8)
    Sm-like (CL0527) LSM14; Scd6-like Sm domain (PF12701; HMM-score: 7.5)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 10
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 0
  • LocateP: Secretory(released) (with CS)
    • Prediction by SwissProt Classification: Extracellular
    • Pathway Prediction: Sec-(SPI)
    • Intracellular Possibility: -0.17
    • Signal Peptide Possibility: 1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: NEASAAAK
  • SignalP: Signal peptide length 31 aa
    • Ymax: 0.669
    • Ymax_pos: 31
    • Cmax: 0.588
    • Cmax_pos: 31
    • Smax: 0.936
    • Smax_pos: 7
    • Smean: 0.835
    • D: 0.734
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MKFKSLITTTLALGVLASTGANFNNNEASAAAKPLDKSSSSLHHGYSKVHVPYAITVNGTSQNILSSLTFNKNQNISYKDLEDRVKSVLKSDRGISDIDLRLSKQAKYTVYFKNGTKKVIDLKAGIYTADLINTSEIKAININVDTKKQVEDKKKDKANYQVPYTITVNGTSQNILSNLTFNKNQNISYKDLEDKVKSVLESNRGITDVDLRLSKQAKYTVNFKNGTKKVIDLKSGIYTANLINSSDIKSININVDTKKHIENKAKRNYQVPYSINLNGTSTNILSNLSFSNKPWTNYKNLTSQIKSVLKHDRGISEQDLKYAKKAYYTVYFKNGGKRILQLNSKNYTANLVHAKDVKRIEITVKTGTKAKADRYVPYTIAVNGTSTPILSDLKFTGDPRVGYKDISKKVKSVLKHDRGIGERELKYAKKATYTVHFKNGTKKVININSNISQLNLLYVQDIKKIDIDVKTGTKAKADSYVPYTIAVNGTSTPILSKLKISNKQLISYKYLNDKVKSVLKSERGISDLDLKFAKQAKYTVYFKNGKKQVVNLKSDIFTPNLFSAKDIKKIDIDVKQYTKSKKNK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • map no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]