From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS00605 [old locus tag: NWMN_0109 ]
  • pan locus tag?: SAUPAN000993000
  • symbol: NWMN_RS00605
  • pan gene symbol?: capO
  • synonym:
  • product: UDP-N-acetyl-D-mannosamine dehydrogenase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_RS00605 [old locus tag: NWMN_0109 ]
  • symbol: NWMN_RS00605
  • product: UDP-N-acetyl-D-mannosamine dehydrogenase
  • replicon: chromosome
  • strand: +
  • coordinates: 133553..134815
  • length: 1263
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_009641 (133553..134815) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    ATGAAGTTAACAGTAGTTGGCTTAGGTTATATTGGTTTACCAACATCAATTATGTTTGCA
    AAACATGGCGTCGATGTGCTTGGTGTTGATATTAATCAGCAAACGATTGATAAGTTACAA
    AGTGGTCAAATTAGTATTGAAGAACCTGGATTACAAGAGGTTTATGAAGAGGTACTGTCA
    TCGGGAAAATTGAAGGTATCTACAACGCCAGATGCATCTGATGTTTTTATCATTGCCGTT
    CCGACGCCGAATAATGATGATCAGTACCGGTCATGTGACATTTCGCTAGTTATGCGTGCA
    TTAGATAGTATTTTATCATTTTTAGAAAAAGGAAATACCATTATTGTAGAGTCGACAATT
    GCGCCTAAAACGATGGATGATTTTGTAAAACCAGTCATTGAAAATTTAGGGTTTACAATA
    GGTGAAGATATTTATTTAGTGCATTGTCCAGAACGTGTACTGCCAGGAAAAATTTTAGAA
    GAATTAGTTCATAACAATCGTATCATTGGCGGTGTGACTGAAGCTTGTATTGAAGCGGGT
    AAACGTGTCTATCGCACATTCGTTCAGGGAGAAATGATTGAAACAGATGCACGTACTGCT
    GAAATGAGTAAGCTAATGGAAAACACATATAGAGACGTGAACATTGCTTTAGCTAATGAA
    TTAACAAAAATTTGCAATAACTTAAATATTAATGTATTAGATGTGATTGAAATGGCAAAC
    AAACATCCGCGTGTTAACATCCATCAGCCTGGTCCAGGTGTAGGCGGTCATTGTTTAGCT
    GTTGATCCGTACTTTATTATTGCTAAAGACCCTGAAAATGCAAAGTTAATTCAAACTGGA
    CGTGAAATTAATAATTCAATGCCGGCCTATGTTGTTGATACAACGAAGCAAATCATCAAA
    GTGTTGAGCGGGAATAAAGTCACAGTATTTGGTTTAACTTATAAAGGTGATGTTGATGAT
    ATAAGAGAATCACCAGCATTTGATATTTATGAGCTATTAAATCAAGAACCAGACATAGAA
    GTATGTGCTTATGATCCACATGTTGAATTAGATTTTGTGGAACATGATATGTCACATGCT
    GTCAAAGACGCATCGCTAGTATTGATTTTAAGTGACCACTCAGAATTTAAAAATTTATCG
    GACAGTCATTTTGATAAAATGAAGCATAAAGTGATTTTTGATACAAAAAATGTTGTGAAA
    TCATCATTTGAAGATGTATCGTATTATAATTATGGCAATATATTTAATTTTATCGACAAA
    TAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1263

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_RS00605 [old locus tag: NWMN_0109 ]
  • symbol: NWMN_RS00605
  • description: UDP-N-acetyl-D-mannosamine dehydrogenase
  • length: 420
  • theoretical pI: 4.58484
  • theoretical MW: 46800.1
  • GRAVY: -0.109048

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    nucleotide sugar dehydrogenase (TIGR03026; HMM-score: 470.5)
    2-hydroxy-3-oxopropionate reductase (TIGR01505; EC 1.1.1.60; HMM-score: 23.6)
    MetabolismAmino acid biosynthesisOtherpyrrolysine biosynthesis protein PylD (TIGR03911; HMM-score: 17.9)
    MetabolismEnergy metabolismPentose phosphate pathway6-phosphogluconate dehydrogenase (decarboxylating) (TIGR00872; EC 1.1.1.44; HMM-score: 14.4)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersPantothenate and coenzyme A2-dehydropantoate 2-reductase (TIGR00745; EC 1.1.1.-; HMM-score: 13.4)
    MetabolismEnergy metabolismAmino acids and amines3-hydroxyisobutyrate dehydrogenase (TIGR01692; EC 1.1.1.31; HMM-score: 10.2)
  • TheSEED:
  • PFAM:
    NADP_Rossmann (CL0063) UDPG_MGDP_dh_N; UDP-glucose/GDP-mannose dehydrogenase family, NAD binding domain (PF03721; HMM-score: 202.4)
    6PGD_C (CL0106) UDPG_MGDP_dh; UDP-glucose/GDP-mannose dehydrogenase family, central domain (PF00984; HMM-score: 91.1)
    HUP (CL0039) UDPG_MGDP_dh_C; UDP-glucose/GDP-mannose dehydrogenase family, UDP binding domain (PF03720; HMM-score: 81.5)
    NADP_Rossmann (CL0063) NAD_binding_2; NAD binding domain of 6-phosphogluconate dehydrogenase (PF03446; HMM-score: 23.5)
    ApbA; Ketopantoate reductase PanE/ApbA (PF02558; HMM-score: 19.8)
    3HCDH_N; 3-hydroxyacyl-CoA dehydrogenase, NAD binding domain (PF02737; HMM-score: 19.3)
    no clan definedLAMTOR; Late endosomal/lysosomal adaptor and MAPK and MTOR activator (PF15454; HMM-score: 14.4)
    NADP_Rossmann (CL0063) 2-Hacid_dh_C; D-isomer specific 2-hydroxyacid dehydrogenase, NAD binding domain (PF02826; HMM-score: 13.4)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.286
    • Ymax_pos: 21
    • Cmax: 0.24
    • Cmax_pos: 21
    • Smax: 0.542
    • Smax_pos: 18
    • Smean: 0.311
    • D: 0.296
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446702151 NCBI
  • RefSeq: WP_000779497 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MKLTVVGLGYIGLPTSIMFAKHGVDVLGVDINQQTIDKLQSGQISIEEPGLQEVYEEVLSSGKLKVSTTPDASDVFIIAVPTPNNDDQYRSCDISLVMRALDSILSFLEKGNTIIVESTIAPKTMDDFVKPVIENLGFTIGEDIYLVHCPERVLPGKILEELVHNNRIIGGVTEACIEAGKRVYRTFVQGEMIETDARTAEMSKLMENTYRDVNIALANELTKICNNLNINVLDVIEMANKHPRVNIHQPGPGVGGHCLAVDPYFIIAKDPENAKLIQTGREINNSMPAYVVDTTKQIIKVLSGNKVTVFGLTYKGDVDDIRESPAFDIYELLNQEPDIEVCAYDPHVELDFVEHDMSHAVKDASLVLILSDHSEFKNLSDSHFDKMKHKVIFDTKNVVKSSFEDVSYYNYGNIFNFIDK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • NWMN_RS00605 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]