From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS05995 [old locus tag: NWMN_1062 ]
  • pan locus tag?: SAUPAN003389000
  • symbol: NWMN_RS05995
  • pan gene symbol?: sdhB
  • synonym:
  • product: succinate dehydrogenase iron-sulfur subunit

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_RS05995 [old locus tag: NWMN_1062 ]
  • symbol: NWMN_RS05995
  • product: succinate dehydrogenase iron-sulfur subunit
  • replicon: chromosome
  • strand: +
  • coordinates: 1166954..1167769
  • length: 816
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_009641 (1166954..1167769) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    ATGACTGAACAATCAGTGAAAAACACTCCACAACATGAAACACAATCTAAACCGAAACAA
    AAAACAGTAAAATTAATTATTAAACGACAAGATACAAGTGATTCTAAGCCTTATGAAGAA
    ACATTTGAAATTCCATATCGTGAAAATTTAAACGTCATTGCTTGTTTAATGGAAATTAGA
    CGTAACCCAGTTAATATTAAAGGTGAAAAAACAACACCTGTTGTCTGGGATATGAACTGC
    TTAGAAGAAGTATGTGGAGCATGTTCTATGGTTATCAATGGTCGTGCAAGACAATCTTGT
    TCTGCGATTGTTGATCAATTAGAACAACCTATTCGTTTAGAGCCAATGAATACTTTCCCA
    GTTATCCGTGACTTACAAGTTGATCGTTCTAGAATGTTCGATAACTTAAAACGTATGAAA
    GCATGGATCCCAATTGATGGAACGTATGATTTAGGTCCGGGACCACGTATGCCAGAGAAA
    AAACGTCAAACAGCTTATGAATTATCTAAATGTATGACATGTGGTGTATGTTTAGAGGTT
    TGTCCTAATGTTACTGAAAATAATAAATTCGTTGGTGCACAAGCAATCTCGCAAGTTCGT
    TTGTTTAATTTGCACCCAACAGGATCTATGACTAAAGATGAACGTTTAAATGCATTAATG
    GGTACTGGTGGCTTACAGCAGTGTGGTAATTCACAAAACTGTGTTAATGCTTGCCCTAAA
    GGTATTCCATTAACAACATCCATTGCAGCAATGAACAGAGAAACAACATTCCACATGTTT
    AAATCATTCTTTGGTTCAGACCATGAAGTAGAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    816

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_RS05995 [old locus tag: NWMN_1062 ]
  • symbol: NWMN_RS05995
  • description: succinate dehydrogenase iron-sulfur subunit
  • length: 271
  • theoretical pI: 7.99685
  • theoretical MW: 30583.1
  • GRAVY: -0.501845

Function[edit source | edit]

  • reaction:
    EC 1.3.99.1?  ExPASy
    Deleted entry
  • TIGRFAM:
    MetabolismEnergy metabolismTCA cyclesuccinate dehydrogenase and fumarate reductase iron-sulfur protein (TIGR00384; HMM-score: 137.1)
    MetabolismEnergy metabolismAnaerobicsuccinate dehydrogenase and fumarate reductase iron-sulfur protein (TIGR00384; HMM-score: 137.1)
    MetabolismEnergy metabolismAerobicsuccinate dehydrogenase and fumarate reductase iron-sulfur protein (TIGR00384; HMM-score: 137.1)
    MetabolismEnergy metabolismElectron transportNADH-quinone oxidoreductase, chain I (TIGR01971; HMM-score: 19)
    Unknown functionGeneralarchaeoflavoprotein, MJ0208 family (TIGR02700; HMM-score: 18.7)
    cytochrome c oxidase accessory protein CcoG (TIGR02745; HMM-score: 18)
    CoB--CoM heterodisulfide reductase, subunit C (TIGR03290; EC 1.8.98.1; HMM-score: 15.4)
    4-hydroxybenzoyl-CoA reductase, gamma subunit (TIGR03193; EC 1.3.7.9; HMM-score: 15.1)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesOtherselenium-dependent xanthine dehydrogenase (TIGR03311; EC 1.17.1.4; HMM-score: 15.1)
    pyruvate:ferredoxin (flavodoxin) oxidoreductase (TIGR02176; EC 1.2.7.1; HMM-score: 14.1)
    MetabolismEnergy metabolismAmino acids and aminescholine TMA-lyase-activating enzyme (TIGR04395; EC 1.97.-.-; HMM-score: 13.8)
    MetabolismEnergy metabolismAnaerobicglycerol-3-phosphate dehydrogenase, anaerobic, C subunit (TIGR03379; EC 1.1.5.3; HMM-score: 13.5)
    2-oxoacid:acceptor oxidoreductase, delta subunit, pyruvate/2-ketoisovalerate family (TIGR02179; HMM-score: 13.2)
    MetabolismEnergy metabolismElectron transportNADH-plastoquinone oxidoreductase, I subunit (TIGR00403; EC 1.6.5.3; HMM-score: 13.1)
    MetabolismEnergy metabolismElectron transportiron-sulfur cluster-binding protein (TIGR00273; HMM-score: 12)
    MetabolismEnergy metabolismMethanogenesisputative methanogenesis marker 16 metalloprotein (TIGR03287; HMM-score: 11.9)
    Genetic information processingProtein synthesistRNA and rRNA base modificationepoxyqueuosine reductase (TIGR00276; EC 1.-.-.-; HMM-score: 11.8)
    MetabolismEnergy metabolismElectron transportcytochrome c nitrite reductase, Fe-S protein (TIGR03149; EC 1.7.2.2; HMM-score: 11.5)
    MetabolismEnergy metabolismElectron transportferredoxin-type protein NapF (TIGR00402; HMM-score: 10.3)
    [FeFe] hydrogenase, group A (TIGR02512; EC 1.12.-.-; HMM-score: 9.9)
    MetabolismEnergy metabolismChemoautotrophyCO dehydrogenase/acetyl-CoA synthase complex, epsilon subunit (TIGR00314; EC 1.2.99.2; HMM-score: 9.4)
    methylamine methyltransferase corrinoid protein reductive activase (TIGR04270; HMM-score: 9.4)
    MetabolismCentral intermediary metabolismNitrogen fixationferredoxin III, nif-specific (TIGR02936; HMM-score: 8.2)
    MetabolismEnergy metabolismElectron transportelectron transport complex, RnfABCDGE type, C subunit (TIGR01945; HMM-score: 7.7)
    glycyl-radical enzyme activating protein (TIGR02494; EC 1.97.1.-; HMM-score: 6.8)
    Genetic information processingProtein fateProtein modification and repairglycine radical enzyme activase, YjjW family (TIGR04041; EC 1.97.1.-; HMM-score: 6.6)
    ferredoxin-type protein, NapH/MauN family (TIGR02163; HMM-score: 6.5)
    MetabolismCentral intermediary metabolismSulfur metabolismsulfite reductase, dissimilatory-type beta subunit (TIGR02066; EC 1.8.99.3; HMM-score: 5.3)
  • TheSEED:
  • PFAM:
    Fer2 (CL0486) Fer2_3; 2Fe-2S iron-sulfur cluster binding domain (PF13085; HMM-score: 97.9)
    4Fe-4S (CL0344) Fer4_8; 4Fe-4S dicluster domain (PF13183; HMM-score: 35.6)
    Fer4_7; 4Fe-4S dicluster domain (PF12838; HMM-score: 33.9)
    Fer4_9; 4Fe-4S dicluster domain (PF13187; HMM-score: 30.5)
    Fer4_10; 4Fe-4S dicluster domain (PF13237; HMM-score: 28.2)
    Fer4_17; 4Fe-4S dicluster domain (PF13534; HMM-score: 25.6)
    Fer4_16; 4Fe-4S double cluster binding domain (PF13484; HMM-score: 19.5)
    Fer4_2; 4Fe-4S binding domain (PF12797; HMM-score: 19.3)
    Fer4; 4Fe-4S binding domain (PF00037; HMM-score: 17.8)
    Fer4_15; 4Fe-4S single cluster domain (PF13459; HMM-score: 17.2)
    Fer4_13; 4Fe-4S single cluster domain of Ferredoxin I (PF13370; HMM-score: 16.8)
    Fer4_21; 4Fe-4S dicluster domain (PF14697; HMM-score: 14.7)
    Fer4_6; 4Fe-4S binding domain (PF12837; HMM-score: 13.8)
    Fer4_4; 4Fe-4S binding domain (PF12800; HMM-score: 12.9)
    Fer4_18; 4Fe-4S dicluster domain (PF13746; HMM-score: 11.5)
    Fer4_3; 4Fe-4S binding domain (PF12798; HMM-score: 9.8)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.89
    • Cytoplasmic Membrane Score: 0.09
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.152
    • Ymax_pos: 17
    • Cmax: 0.104
    • Cmax_pos: 13
    • Smax: 0.286
    • Smax_pos: 10
    • Smean: 0.21
    • D: 0.175
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446061857 NCBI
  • RefSeq: WP_000139712 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MTEQSVKNTPQHETQSKPKQKTVKLIIKRQDTSDSKPYEETFEIPYRENLNVIACLMEIRRNPVNIKGEKTTPVVWDMNCLEEVCGACSMVINGRARQSCSAIVDQLEQPIRLEPMNTFPVIRDLQVDRSRMFDNLKRMKAWIPIDGTYDLGPGPRMPEKKRQTAYELSKCMTCGVCLEVCPNVTENNKFVGAQAISQVRLFNLHPTGSMTKDERLNALMGTGGLQQCGNSQNCVNACPKGIPLTTSIAAMNRETTFHMFKSFFGSDHEVE

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • NWMN_RS05995 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]