From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS06760 [old locus tag: NWMN_1201 ]
  • pan locus tag?: SAUPAN003596000
  • symbol: NWMN_RS06760
  • pan gene symbol?: miaB
  • synonym:
  • product: tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_RS06760 [old locus tag: NWMN_1201 ]
  • symbol: NWMN_RS06760
  • product: tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB
  • replicon: chromosome
  • strand: +
  • coordinates: 1323906..1325450
  • length: 1545
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_009641 (1323906..1325450) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    GTGAACGAAGAACAAAGAAAAGCAAGTTCTGTAGATGTTTTAGCTGAGAGAGATAAGAAA
    GCAGAAAAAGATTATAGTAAATATTTTGAACATGTTTATCAGCCGCCTAATTTAAAAGAA
    GCGAAAAAAAGAGGTAAACAAGAAGTTCGTTATAATAGAGATTTCCAAATTGATGAAAAA
    TATCGCGGTATGGGGAACGAGCGTACATTTTTAATTAAAACATATGGATGTCAAATGAAT
    GCACATGACACTGAGGTCATTGCTGGTATACTTGAAGCATTAGGCTATCAAGCAACGACT
    GATATTAACACTGCAGATGTTATTTTAATTAATACATGTGCGATTAGAGAAAATGCCGAG
    AACAAAGTGTTTAGTGAAATAGGTAATTTGAAGCATTTGAAAAAAGAACGACCTGATATT
    TTAATCGGTGTTTGTGGTTGTATGTCACAAGAAGAGTCAGTAGTGAATAAAATTTTAAAA
    TCGTATCAAAATGTAGATATGATATTTGGTACACATAATATTCATCATTTACCAGAAATT
    TTAGAAGAAGCATACTTATCTAAAGCAATGGTTGTTGAAGTATGGTCTAAAGAAGGAGAC
    GTTATTGAAAATCTTCCAAAAGTCCGTGAAGGCAACATTAAAGCATGGGTCAATATTATG
    TATGGTTGTGATAAGTTTTGTACATATTGTATTGTTCCATTTACAAGAGGTAAAGAACGA
    AGCCGTAGACCTGAAGACATTATAGATGAAGTACGTGAACTTGCTCGTGAAGGTTACAAA
    GAAATAACGCTTTTAGGTCAAAATGTAAATTCTTATGGTAAAGATTTACAGGATATAGAA
    TATGACTTAGGAGATCTTTTACAAGCAATTTCTAAAATAGCGATTCCAAGAGTTCGTTTC
    ACAACAAGTCATCCTTGGGACTTTACAGATCACATGATTGATGTTATTTCAGAGGGTGGT
    AATATCGTTCCGCATATCCACTTGCCAGTTCAATCTGGAAATAATGCAGTATTAAAAATA
    ATGGGTAGAAAATATACACGAGAAAGTTATTTGGATTTAGTAAAACGAATCAAAGATAGA
    ATTCCTAATGTAGCATTAACTACAGATATTATTGTAGGGTATCCAAATGAATCAGAGGAA
    CAATTTGAAGAAACTTTAACTCTGTATGATGAAGTTGGTTTTGAACATGCATATACGTAC
    TTGTATTCACAACGTGATGGTACGCCTGCTGCTAAAATGAAAGATAATGTACCTTTAAAT
    GTCAAAAAGGAACGATTGCAACGTTTGAATAAAAAAGTTGGTCATTATTCACAAATAGCT
    ATGAGTAAGTACGAAGGACAAACTGTAACAGTACTTTGTGAAGGAAGTAGTAAAAAAGAT
    GATCAGGTTCTTGCTGGCTACACTGATAAAAATAAGCTAGTTAATTTCAAAGCGCCTAAA
    GAAATGATTGGTAAACTAGTGGAAGTACGAATAGATGAAGCTAAACAGTATTCATTAAAT
    GGCAGTTTTATAAAGGAAGTAGAGCCGGAAATGGTGATTCAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1545

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_RS06760 [old locus tag: NWMN_1201 ]
  • symbol: NWMN_RS06760
  • description: tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB
  • length: 514
  • theoretical pI: 6.26459
  • theoretical MW: 58930.8
  • GRAVY: -0.545914

Function[edit source | edit]

  • reaction:
    EC 2.8.4.3?  ExPASy
    tRNA-2-methylthio-N6-dimethylallyladenosine synthaseN6-dimethylallyladenine37 in tRNA + sulfur-(sulfur carrier) + 2 S-adenosyl-L-methionine + reduced electron acceptor = 2-methylthio-N6-dimethylallyladenine37 in tRNA + S-adenosyl-L-homocysteine + (sulfur carrier) + L-methionine + 5'-deoxyadenosine + electron acceptor
  • TIGRFAM:
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA-i(6)A37 thiotransferase enzyme MiaB (TIGR01574; EC 2.-.-.-; HMM-score: 630.8)
    radical SAM methylthiotransferase, MiaB/RimO family (TIGR00089; EC 2.1.1.-,2.8.1.-; HMM-score: 528)
    Genetic information processingProtein synthesistRNA and rRNA base modificationMiaB-like tRNA modifying enzyme (TIGR01579; HMM-score: 334.6)
    Genetic information processingProtein synthesisRibosomal proteins: synthesis and modificationribosomal protein S12 methylthiotransferase RimO (TIGR01125; EC 2.1.1.-,2.8.1.-; HMM-score: 284.3)
    Genetic information processingProtein synthesistRNA and rRNA base modificationMiaB-like tRNA modifying enzyme, archaeal-type (TIGR01578; HMM-score: 261.7)
    Unknown functionEnzymes of unknown specificityB12-binding domain/radical SAM domain protein, MJ_0865 family (TIGR04014; HMM-score: 82.7)
    Unknown functionEnzymes of unknown specificityB12-binding domain/radical SAM domain protein, MJ_1487 family (TIGR04013; HMM-score: 63.1)
    Cellular processesCellular processesToxin production and resistanceradical SAM P-methyltransferase, PhpK family (TIGR04479; EC 2.1.-.-; HMM-score: 40)
    hopanoid biosynthesis associated radical SAM protein HpnJ (TIGR03471; HMM-score: 29.5)
    putative heme utilization radical SAM enzyme HutW (TIGR04107; HMM-score: 29.3)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersHeme, porphyrin, and cobalamincoproporphyrinogen dehydrogenase HemZ (TIGR03994; EC 1.3.99.22; HMM-score: 22.7)
    Unknown functionEnzymes of unknown specificityradical SAM protein, TIGR01212 family (TIGR01212; HMM-score: 22.6)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersHeme, porphyrin, and cobalaminputative oxygen-independent coproporphyrinogen III oxidase (TIGR00539; EC 1.3.99.22; HMM-score: 15.4)
    putative variant cofactor biosynthesis B12-binding domain/radical SAM domain protein 1 (TIGR04385; HMM-score: 14.2)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersHeme, porphyrin, and cobalaminoxygen-independent coproporphyrinogen III oxidase (TIGR00538; EC 1.3.99.22; HMM-score: 13.9)
    Cellular processesCellular processesToxin production and resistancetryptophan 2-C-methyltransferase (TIGR04428; EC 2.1.1.106; HMM-score: 13.2)
    Unknown functionEnzymes of unknown specificityuncharacterized radical SAM protein YgiQ (TIGR03904; HMM-score: 12.9)
    magnesium-protoporphyrin IX monomethyl ester anaerobic oxidative cyclase (TIGR02026; HMM-score: 11.7)
  • TheSEED:
  • PFAM:
    TIM_barrel (CL0036) Radical_SAM; Radical SAM superfamily (PF04055; HMM-score: 119.1)
    CheY (CL0304) UPF0004; Uncharacterized protein family UPF0004 (PF00919; HMM-score: 103)
    OB (CL0021) TRAM; TRAM domain (PF01938; HMM-score: 50)
    NTF2 (CL0051) DUF3887; Protein of unknown function (DUF3887) (PF13026; HMM-score: 14.7)
    TIM_barrel (CL0036) AP_endonuc_2; Xylose isomerase-like TIM barrel (PF01261; HMM-score: 13.4)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors: [4Fe-4S] cluster
  • effectors:
  • protein partners:
    NWMN_RS02965elongation factor Tu  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.115
    • Ymax_pos: 47
    • Cmax: 0.106
    • Cmax_pos: 9
    • Smax: 0.196
    • Smax_pos: 40
    • Smean: 0.093
    • D: 0.107
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446924267 NCBI
  • RefSeq: WP_001001523 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MNEEQRKASSVDVLAERDKKAEKDYSKYFEHVYQPPNLKEAKKRGKQEVRYNRDFQIDEKYRGMGNERTFLIKTYGCQMNAHDTEVIAGILEALGYQATTDINTADVILINTCAIRENAENKVFSEIGNLKHLKKERPDILIGVCGCMSQEESVVNKILKSYQNVDMIFGTHNIHHLPEILEEAYLSKAMVVEVWSKEGDVIENLPKVREGNIKAWVNIMYGCDKFCTYCIVPFTRGKERSRRPEDIIDEVRELAREGYKEITLLGQNVNSYGKDLQDIEYDLGDLLQAISKIAIPRVRFTTSHPWDFTDHMIDVISEGGNIVPHIHLPVQSGNNAVLKIMGRKYTRESYLDLVKRIKDRIPNVALTTDIIVGYPNESEEQFEETLTLYDEVGFEHAYTYLYSQRDGTPAAKMKDNVPLNVKKERLQRLNKKVGHYSQIAMSKYEGQTVTVLCEGSSKKDDQVLAGYTDKNKLVNFKAPKEMIGKLVEVRIDEAKQYSLNGSFIKEVEPEMVIQ

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • NWMN_RS06760 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]