From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS06790 [old locus tag: NWMN_1207 ]
  • pan locus tag?: SAUPAN003611000
  • symbol: NWMN_RS06790
  • pan gene symbol?: glpF
  • synonym:
  • product: aquaporin family protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_RS06790 [old locus tag: NWMN_1207 ]
  • symbol: NWMN_RS06790
  • product: aquaporin family protein
  • replicon: chromosome
  • strand: +
  • coordinates: 1332290..1333108
  • length: 819
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_009641 (1332290..1333108) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    ATGAATGTATATTTAGCAGAATTCCTAGGAACTGCAATCTTAATCCTTTTTGGTGGTGGC
    GTTTGTGCCAATGTCAATTTAAAGAGAAGTGCTGCGAATGGTGCTGATTGGATTGTCATC
    ACAGCTGGATGGGGATTAGCGGTTACAATGGGTGTGTTTGCTGTCGGTCAATTCTCAGGT
    GCACATTTAAACCCAGCGGTGTCTTTAGCTCTTGCATTAGACGGAAGTTTTGATTGGTCA
    TTAGTTCCTGGTTATATTGTTGCTCAAATGTTAGGTGCAATTGTCGGAGCAACAATTGTA
    TGGTTAATGTACTTGCCACATTGGAAAGCGACAGAAGAAGCTGGCGCGAAATTAGGTGTT
    TTCTCTACAGCACCGGCTATTAAGAATTACTTTGCCAACTTTTTAAGTGAGATTATCGGA
    ACAATGGCATTAACTTTAGGTATTTTATTTATCGGTGTAAACAAAATTGCCGATGGTTTA
    AATCCTTTAATTGTCGGAGCATTAATTGTTGCAATCGGATTAAGTTTAGGCGGTGCTACT
    GGTTATGCAATCAACCCAGCACGTGATTTAGGTCCGAGAATTGCACATGCGATTTTACCA
    ATAGCTGGTAAAGGTGGTTCAAATTGGTCATATGCAATCGTTCCTATCTTAGGACCAATT
    GCCGGTGGTTTATTAGGTGCAGTGGTATACGCTGTATTTTATAAACATACATTTAATATT
    GGTTGTGCAATTGCAATTGTTGTAGTTATTATTACTTTGATTTTAGGTTACATTTTAAAT
    AAATCATCAAAAAAAGGTGATATCGAATCAATTTACTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    819

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_RS06790 [old locus tag: NWMN_1207 ]
  • symbol: NWMN_RS06790
  • description: aquaporin family protein
  • length: 272
  • theoretical pI: 8.61808
  • theoretical MW: 28115.1
  • GRAVY: 0.929044

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    MetabolismTransport and binding proteinsUnknown substrateMIP family channel proteins (TIGR00861; HMM-score: 196.8)
    MetabolismTransport and binding proteinsCations and iron carrying compoundscation diffusion facilitator family transporter (TIGR01297; HMM-score: 12.8)
  • TheSEED:
  • PFAM:
    no clan definedMIP; Major intrinsic protein (PF00230; HMM-score: 153.6)
    FUSC (CL0307) FUSC_2; Fusaric acid resistance protein-like (PF13515; HMM-score: 19.5)
    no clan definedOrthoreo_P10; Orthoreovirus membrane fusion protein p10 (PF07204; HMM-score: 10.3)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 10
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 7
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.296
    • Ymax_pos: 24
    • Cmax: 0.291
    • Cmax_pos: 24
    • Smax: 0.408
    • Smax_pos: 18
    • Smean: 0.274
    • D: 0.287
  • predicted transmembrane helices (TMHMM): 7

Accession numbers[edit source | edit]

  • GI: 447026487 NCBI
  • RefSeq: WP_001103743 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MNVYLAEFLGTAILILFGGGVCANVNLKRSAANGADWIVITAGWGLAVTMGVFAVGQFSGAHLNPAVSLALALDGSFDWSLVPGYIVAQMLGAIVGATIVWLMYLPHWKATEEAGAKLGVFSTAPAIKNYFANFLSEIIGTMALTLGILFIGVNKIADGLNPLIVGALIVAIGLSLGGATGYAINPARDLGPRIAHAILPIAGKGGSNWSYAIVPILGPIAGGLLGAVVYAVFYKHTFNIGCAIAIVVVIITLILGYILNKSSKKGDIESIY

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • NWMN_RS06790 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]