From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS07455 [old locus tag: NWMN_1325 ]
  • pan locus tag?: SAUPAN003830000
  • symbol: NWMN_RS07455
  • pan gene symbol?: sucB
  • synonym:
  • product: dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_RS07455 [old locus tag: NWMN_1325 ]
  • symbol: NWMN_RS07455
  • product: dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex
  • replicon: chromosome
  • strand: -
  • coordinates: 1455873..1457141
  • length: 1269
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_009641 (1455873..1457141) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    ATGCCAGAGGTTAAAGTTCCAGAATTAGCAGAATCTATTACAGAAGGTACCATTGCAGAA
    TGGTTGAAAAACGTAGGGGATAGCGTAGAAAAAGGTGAAGCTATTCTTGAATTAGAAACT
    GATAAAGTTAATGTCGAAGTTGTATCTGAAGAAGCAGGTGTATTATCTGAACAACTTGCA
    AGTGAAGGCGACACTGTAGAAGTTGGACAAGCAATTGCTATCATCGGCGAAGGTAGTGGC
    AATGCTTCTAAAGAAAATAGTAACGACAATACTCCACAACAAAATGAAGAAACAAATAAT
    AAAAAAGAAGAAACAACAAATAATTCGGTAGATAAAGCTGAAGTAAATCAAGCAAATGAT
    GACAATCAGCAACGTATTAATGCTACGCCTTCTGCGCGTCGATATGCTCGTGAAAATGGT
    GTGAATCTTGCTGAAGTAAGTCCGAAAACAAATGATGTGGTTCGTAAAGAAGATATTGAT
    AAGAAACAACAGGCACCGGCATCAACACAAACAACACAACAAGCATCTGCAAAAGAAGAG
    AAAAAATACAATCAATATCCTACAAAACCAGTGATTCGTGAAAAAATGTCACGTAGAAAG
    AAAACAGCTGCCAAAAAATTATTAGAGGTATCTAATAATACAGCTATGTTAACAACATTT
    AACGAAGTTGACATGACAAATGTTATGGAATTGCGTAAACGTAAGAAAGAACAATTTATG
    AAAGATCATGATGGTACTAAATTAGGATTTATGTCATTCTTTACTAAAGCTTCTGTAGCA
    GCTTTGAAAAAGTATCCAGAAGTTAATGCAGAAATCGACGGCGACGACATGATTACGAAA
    CAATATTATGATATTGGTGTAGCTGTTTCTACAGATGATGGATTATTAGTACCATTTGTA
    AGAGATTGTGATAAAAAGAATTTTGCAGAAATCGAAGCAGAAATTGCTAATTTAGCAGTT
    AAAGCACGAGAGAAAAAACTTGGCTTAGATGATATGGTTAATGGTTCATTTACGATTACA
    AATGGCGGTATTTTTGGATCAATGATGAGTACGCCAATTATCAATGGTAATCAAGCTGCA
    ATCTTAGGCATGCATTCAATTATTACAAGACCAATTGCGATTGATCAAGATACAATCGAA
    AATCGTCCAATGATGTATATTGCATTAAGCTATGATCATAGAATTATTGACGGTAAAGAA
    GCAGTTGGATTCTTAAAAACAATTAAAGAATTAATTGAAAACCCAGAAGACTTATTATTA
    GAATCTTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1269

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_RS07455 [old locus tag: NWMN_1325 ]
  • symbol: NWMN_RS07455
  • description: dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex
  • length: 422
  • theoretical pI: 4.57447
  • theoretical MW: 46673.1
  • GRAVY: -0.611848

Function[edit source | edit]

  • reaction:
    EC 2.3.1.61?  ExPASy
    Dihydrolipoyllysine-residue succinyltransferaseSuccinyl-CoA + enzyme N6-(dihydrolipoyl)lysine = CoA + enzyme N6-(S-succinyldihydrolipoyl)lysine
  • TIGRFAM:
    MetabolismEnergy metabolismTCA cycledihydrolipoyllysine-residue succinyltransferase, E2 component of oxoglutarate dehydrogenase (succinyl-transferring) complex (TIGR01347; EC 2.3.1.61; HMM-score: 610.9)
    2-oxoglutarate dehydrogenase, E2 component, dihydrolipoamide succinyltransferase (TIGR02927; EC 2.3.1.61; HMM-score: 303.8)
    MetabolismEnergy metabolismPyruvate dehydrogenasedihydrolipoyllysine-residue acetyltransferase (TIGR01348; EC 2.3.1.12; HMM-score: 269.1)
    MetabolismEnergy metabolismPyruvate dehydrogenasepyruvate dehydrogenase complex dihydrolipoamide acetyltransferase (TIGR01349; EC 2.3.1.12; HMM-score: 249.6)
    MetabolismTransport and binding proteinsCations and iron carrying compoundsoxaloacetate decarboxylase alpha subunit (TIGR01108; EC 4.1.1.3; HMM-score: 22.6)
    MetabolismEnergy metabolismOtheroxaloacetate decarboxylase alpha subunit (TIGR01108; EC 4.1.1.3; HMM-score: 22.6)
    MetabolismCentral intermediary metabolismNitrogen metabolismurea carboxylase (TIGR02712; EC 6.3.4.6; HMM-score: 21.4)
    MetabolismTransport and binding proteinsUnknown substrateefflux transporter, RND family, MFP subunit (TIGR01730; HMM-score: 15.1)
    amphi-Trp domain (TIGR04354; HMM-score: 14.4)
    glycine cleavage protein H-like protein (TIGR03077; HMM-score: 10)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotides2'-Deoxyribonucleotide metabolismthymidylate synthase, flavin-dependent (TIGR02170; EC 2.1.1.148; HMM-score: 7.3)
    MetabolismFatty acid and phospholipid metabolismBiosynthesisacetyl-CoA carboxylase, biotin carboxyl carrier protein (TIGR00531; HMM-score: 5.2)
    MetabolismTransport and binding proteinsCations and iron carrying compoundspotassium uptake protein, Trk family (TIGR00934; HMM-score: 3.4)
  • TheSEED:
  • PFAM:
    CoA-acyltrans (CL0149) 2-oxoacid_dh; 2-oxoacid dehydrogenases acyltransferase (catalytic domain) (PF00198; HMM-score: 266.8)
    Hybrid (CL0105) Biotin_lipoyl; Biotin-requiring enzyme (PF00364; HMM-score: 76.6)
    no clan definedE3_binding; e3 binding domain (PF02817; HMM-score: 29.1)
    Hybrid (CL0105) Biotin_lipoyl_2; Biotin-lipoyl like (PF13533; HMM-score: 21.9)
    HlyD_3; HlyD family secretion protein (PF13437; HMM-score: 15.9)
    RnfC_N; RnfC Barrel sandwich hybrid domain (PF13375; HMM-score: 15.5)
    no clan definedIF3_N; Translation initiation factor IF-3, N-terminal domain (PF05198; HMM-score: 14.5)
    Hybrid (CL0105) PYNP_C; Pyrimidine nucleoside phosphorylase C-terminal domain (PF07831; HMM-score: 13.6)
    P-loop_NTPase (CL0023) LAP1C; Lamina-associated polypeptide 1C (LAP1C) (PF05609; HMM-score: 6.6)
    no clan definedDUF966; Domain of unknown function (DUF966) (PF06136; HMM-score: 6.6)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors: (R)-lipoate
  • effectors:
  • protein partners:
    NWMN_RS05395dihydrolipoyl dehydrogenase  [1] (data from MRSA252)
    NWMN_RS074602-oxoglutarate dehydrogenase E1 component  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.67
    • Cytoplasmic Membrane Score: 0.01
    • Cellwall Score: 0.15
    • Extracellular Score: 0.17
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.1
    • Ymax_pos: 31
    • Cmax: 0.11
    • Cmax_pos: 28
    • Smax: 0.119
    • Smax_pos: 27
    • Smean: 0.078
    • D: 0.091
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 447038184 NCBI
  • RefSeq: WP_001115440 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MPEVKVPELAESITEGTIAEWLKNVGDSVEKGEAILELETDKVNVEVVSEEAGVLSEQLASEGDTVEVGQAIAIIGEGSGNASKENSNDNTPQQNEETNNKKEETTNNSVDKAEVNQANDDNQQRINATPSARRYARENGVNLAEVSPKTNDVVRKEDIDKKQQAPASTQTTQQASAKEEKKYNQYPTKPVIREKMSRRKKTAAKKLLEVSNNTAMLTTFNEVDMTNVMELRKRKKEQFMKDHDGTKLGFMSFFTKASVAALKKYPEVNAEIDGDDMITKQYYDIGVAVSTDDGLLVPFVRDCDKKNFAEIEAEIANLAVKAREKKLGLDDMVNGSFTITNGGIFGSMMSTPIINGNQAAILGMHSIITRPIAIDQDTIENRPMMYIALSYDHRIIDGKEAVGFLKTIKELIENPEDLLLES

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • NWMN_RS07455 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.0 1.1 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]