From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS07640 [old locus tag: NWMN_1354 ]
  • pan locus tag?: SAUPAN003900000
  • symbol: NWMN_RS07640
  • pan gene symbol?:
  • synonym:
  • product: RNA methyltransferase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_RS07640 [old locus tag: NWMN_1354 ]
  • symbol: NWMN_RS07640
  • product: RNA methyltransferase
  • replicon: chromosome
  • strand: -
  • coordinates: 1520174..1521319
  • length: 1146
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_009641 (1520174..1521319) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    ATGTTTCAATTACTTGCAGTTTGTCCGATGGGATTAGAAGCTGTTGTTGCTAGGGAAATT
    CAAGAATTAGGCTATGAAACAAATGTTGAAAATGGTCGTATATTTTTTGAAGGAGACGCA
    AGTGCAATTGTAAAGGCAAATTTATGGTTGCGCACAGCAGACCGAATCAAAATTGTTGTT
    GGACGTTTTAACGCAACAACGTTTGACGAATTATTCGAACAAACCAAAGCGCTCCCTTGG
    GAATCTATAATTGATAAAGAGGGTAACTTCCCAGTTCAAGGTAGAAGCGTTAAATCAACA
    CTACATAGTGTGCCAGATTGTCAGGCGATAACTAAGAAAGCTATTGTTGAACGATTACGT
    CGCGCATATAACGAAAAAGGTTGGTTAAATGAATCAGGTGCCAAATACCCTGTTGAAGTT
    GCCATTTTAAAAGATAATGTATTATTGACTATCGACACATCAGGTTCTGGTTTGAACAGA
    CGTGGTTATAGATTAGCACAAGGTGAAGCACCAATTAAAGAAACGTTGGCAGCAAGTTTA
    ATCCGTCTTGCAAACTGGAAAGGTGATACACCTTTAATTGATCCATTTTGCGGTTCGGGT
    ACAATAGCTATAGAAGCTTGTTTAATTGCTCAAAATATCGCACCTGGTTTTAATCGCGAG
    TTCGTATCAGAGCAATGGAACATCATGCCAGCAAATATTTATGATGATTACCGTGATGAA
    GCGGATAAGATGGCTGATTATGATAAAGAAATCGAAGTATATGCTTCTGATATCGATCCA
    GAAATGGTAGAGATTGCTAAGCGTAACGCTGAAGAAGTTGGGTTGTCTGATATTATTAAA
    TTTAGTGTAAAAGATGTCAATACATTAACAATTGATACAGAAGAACCGGTGGCGTTAATT
    GGAAATCCTCCATATGGTGAACGTATTGGTGATCGTGAAGAAGTTGAAGAAATGTACCGT
    TATATTGGTAAACTAATGAAACAACATCCATTTTTATCTACATACATTTTAACAAGTAAT
    AAAGAATTTGAATATTTAGTAGATCGTAAAGCAACAAAGCGACGTAAGTTATTTAATGGA
    TATATAGAATGTACTTATTATCAATACTGGGGTAAAAAGACAGAACGTAAAACTATTGAA
    AACTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1146

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_RS07640 [old locus tag: NWMN_1354 ]
  • symbol: NWMN_RS07640
  • description: RNA methyltransferase
  • length: 381
  • theoretical pI: 4.78856
  • theoretical MW: 43333
  • GRAVY: -0.376115

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Hypothetical proteinsConservedputative methyltransferase, TIGR01177 family (TIGR01177; HMM-score: 51.9)
    Genetic information processingProtein fateProtein modification and repairprotein-(glutamine-N5) methyltransferase, release factor-specific (TIGR03534; EC 2.1.1.-; HMM-score: 32.6)
    Genetic information processingProtein fateProtein modification and repairmethyltransferase, HemK family (TIGR00536; HMM-score: 30.1)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersChlorophyll and bacteriochlorphyllmagnesium protoporphyrin O-methyltransferase (TIGR02021; EC 2.1.1.11; HMM-score: 19.8)
    Genetic information processingDNA metabolismRestriction/modificationtype II restriction m6 adenine DNA methyltransferase, Alw26I/Eco31I/Esp3I family (TIGR02987; EC 2.1.1.72; HMM-score: 19)
    Genetic information processingProtein synthesisRibosomal proteins: synthesis and modificationprotein-(glutamine-N5) methyltransferase, ribosomal protein L3-specific (TIGR03533; EC 2.1.1.-; HMM-score: 19)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersHeme, porphyrin, and cobalaminprecorrin-6Y C5,15-methyltransferase (decarboxylating), CbiT subunit (TIGR02469; EC 2.1.1.132; HMM-score: 16.2)
    Genetic information processingProtein synthesistRNA and rRNA base modification23S rRNA (uracil-5-)-methyltransferase RumA (TIGR00479; EC 2.1.1.-; HMM-score: 15.6)
    Genetic information processingProtein synthesisRibosomal proteins: synthesis and modificationputative protein-(glutamine-N5) methyltransferase, unknown substrate-specific (TIGR03704; EC 2.1.1.-; HMM-score: 14.5)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMenaquinone and ubiquinoneubiquinone/menaquinone biosynthesis methyltransferase (TIGR01934; EC 2.1.1.-; HMM-score: 12.4)
    Genetic information processingProtein synthesisRibosomal proteins: synthesis and modificationribosomal protein L11 methyltransferase (TIGR00406; EC 2.1.1.-; HMM-score: 12.1)
  • TheSEED:
  • PFAM:
    NADP_Rossmann (CL0063) UPF0020; Putative RNA methylase family UPF0020 (PF01170; HMM-score: 196.7)
    no clan definedTHUMP; THUMP domain (PF02926; HMM-score: 45.4)
    NADP_Rossmann (CL0063) Methyltransf_31; Methyltransferase domain (PF13847; HMM-score: 23.8)
    Methyltransf_25; Methyltransferase domain (PF13649; HMM-score: 21.2)
    N6_N4_Mtase; DNA methylase (PF01555; HMM-score: 17.1)
    no clan definedDUF5027; Domain of unknown function (DUF5027) (PF16430; HMM-score: 15.9)
    NADP_Rossmann (CL0063) MTS; Methyltransferase small domain (PF05175; HMM-score: 15.8)
    Cons_hypoth95; Conserved hypothetical protein 95 (PF03602; HMM-score: 15)
    Methyltransf_11; Methyltransferase domain (PF08241; HMM-score: 14.8)
    Methyltransf_15; RNA cap guanine-N2 methyltransferase (PF09445; HMM-score: 14.4)
    PrmA; Ribosomal protein L11 methyltransferase (PrmA) (PF06325; HMM-score: 13.1)
    Met_10; Met-10+ like-protein (PF02475; HMM-score: 12.9)
    Methyltransf_18; Methyltransferase domain (PF12847; HMM-score: 12.1)
    TRM; N2,N2-dimethylguanosine tRNA methyltransferase (PF02005; HMM-score: 11.8)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.167
    • Ymax_pos: 18
    • Cmax: 0.143
    • Cmax_pos: 43
    • Smax: 0.382
    • Smax_pos: 17
    • Smean: 0.246
    • D: 0.198
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446409295 NCBI
  • RefSeq: WP_000487150 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MFQLLAVCPMGLEAVVAREIQELGYETNVENGRIFFEGDASAIVKANLWLRTADRIKIVVGRFNATTFDELFEQTKALPWESIIDKEGNFPVQGRSVKSTLHSVPDCQAITKKAIVERLRRAYNEKGWLNESGAKYPVEVAILKDNVLLTIDTSGSGLNRRGYRLAQGEAPIKETLAASLIRLANWKGDTPLIDPFCGSGTIAIEACLIAQNIAPGFNREFVSEQWNIMPANIYDDYRDEADKMADYDKEIEVYASDIDPEMVEIAKRNAEEVGLSDIIKFSVKDVNTLTIDTEEPVALIGNPPYGERIGDREEVEEMYRYIGKLMKQHPFLSTYILTSNKEFEYLVDRKATKRRKLFNGYIECTYYQYWGKKTERKTIEN

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • NWMN_RS07640 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]