From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS08320 [old locus tag: NWMN_1477 ]
  • pan locus tag?: SAUPAN004157000
  • symbol: NWMN_RS08320
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_RS08320 [old locus tag: NWMN_1477 ]
  • symbol: NWMN_RS08320
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 1643692..1644375
  • length: 684
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_009641 (1643692..1644375) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    ATGACAACTATCTTGGAATCAACGGCTGGAGATACTTGGGTTGAACAAGTTAGCAATATA
    ATTGTTCAACCTATTTTTACGTTAATATTAACCTGTTTGACATTCTTAGGATTTGTATAT
    CAACTTTACTCTAAAAAAATCAATGCAGCTGGTATTATCGCCACATTATCATTACTTATT
    TTATTTTTGGGATTTCTAATCCAAGGAAATGTCAATATGCATTCTATCTTAATATTCTCA
    ATTGGCGTTATATTAGTTGTAATTGAATTATTTGTAGTTGGTGCAGTAATTGGTATTATT
    GGCATGATACTGATAACTATAAGCATAACAACGCTCGGTGATAATTTGCTATTTATGCTT
    GCGAATGTTATCGTTGCCTTGATTTTAACGATTGTAGAATGGGTGATATTAGTGAAGATT
    TTCAACAGAAAGATTCCGTTTTTGGATAAAGTTATCTTAAAAGATTCAACTAATTCTGAG
    TCAGGTTACAATTCTCATGATAACCGCTCGCACCTCGTAGGAAAGACTGCTCAAACAGTT
    ACAGATCTTCGACCTGCAGGGATTATTTTTTGTGAAAATGAACGTATTGATGCTGTTTCA
    GATGGCAACTTTATTTTGCGCAATAAAACGGTAAAAATCCTTGAAGTTGAAGGAACAAGA
    GTAGTTGTGAGGGAAGTAGATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    684

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_RS08320 [old locus tag: NWMN_1477 ]
  • symbol: NWMN_RS08320
  • description: hypothetical protein
  • length: 227
  • theoretical pI: 5.68735
  • theoretical MW: 25002.5
  • GRAVY: 0.843172

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    oligosaccharyl transferase, archaeosortase A system-associated (TIGR04154; EC 2.4.1.-; HMM-score: 2.7)
  • TheSEED:
  • PFAM:
    no clan definedFAM70; FAM70 protein (PF14967; HMM-score: 9.8)
    Competence; Competence protein (PF03772; HMM-score: 7.3)
    Peptidase_MA (CL0126) DUF3810; Protein of unknown function (DUF3810) (PF12725; HMM-score: 5.7)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.01
    • Cytoplasmic Membrane Score: 9.35
    • Cellwall Score: 0.32
    • Extracellular Score: 0.32
    • Internal Helices: 4
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.102
    • Ymax_pos: 70
    • Cmax: 0.123
    • Cmax_pos: 50
    • Smax: 0.142
    • Smax_pos: 69
    • Smean: 0.057
    • D: 0.085
  • predicted transmembrane helices (TMHMM): 4

Accession numbers[edit source | edit]

  • GI: 487718435 NCBI
  • RefSeq: WP_001802667 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MTTILESTAGDTWVEQVSNIIVQPIFTLILTCLTFLGFVYQLYSKKINAAGIIATLSLLILFLGFLIQGNVNMHSILIFSIGVILVVIELFVVGAVIGIIGMILITISITTLGDNLLFMLANVIVALILTIVEWVILVKIFNRKIPFLDKVILKDSTNSESGYNSHDNRSHLVGKTAQTVTDLRPAGIIFCENERIDAVSDGNFILRNKTVKILEVEGTRVVVREVD

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • NWMN_RS08320 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]