From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS09355 [old locus tag: NWMN_1667 ]
  • pan locus tag?: SAUPAN004467000
  • symbol: NWMN_RS09355
  • pan gene symbol?:
  • synonym:
  • product: autolysin

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_RS09355 [old locus tag: NWMN_1667 ]
  • symbol: NWMN_RS09355
  • product: autolysin
  • replicon: chromosome
  • strand: -
  • coordinates: 1863621..1864475
  • length: 855
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_009641 (1863621..1864475) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    ATGAATAAACACAAGAAAGGTTCTATTTTTGGAATAATAGGACTTGTTGTCATATTTGCT
    GTTGTCTCATTTTTATTTTTCTCAATGATATCCGATCAGATATTTTTCAAACATGTTAAA
    TCCGACATTAAGATTGAAAAGTTAAATGTTACATTAAACGATGCAGCAAAGAAACAAATA
    AATAATTATACGAGTCAACAGGTATCAAATAAAAAGAATGATGCATGGAGAGATGCATCT
    GCAACTGAAATTAAAAGTGCAATGGATAGCGGTACTTTTATCGATAATGAAAAGCAAAAA
    TATCAATTTTTAGATTTATCAAAGTATCAAGGGATTGATAAAAATAGAATTAAACGTATG
    TTAGTAGATAGACCAACGTTATTGAAACATACGGATGATTTCTTAAAAGCTGCTAAAGAT
    AAGCACGTTAACGAAGTTTATTTAATTTCACATGCATTATTAGAAACTGGCGCAGTTAAA
    AGTGAATTAGCTAATGGAGTCGAAATTGATGGCAAAAAGTACTACAATTTCTATGGAGTA
    GGAGCCCTTGATAAAGACCCAATTAAAACAGGTGCAGAATATGCTAAAAAGCATGGTTGG
    GATACACCTGAAAAAGCTATTTCAGGCGGTGCTGATTTCATTCATAAGCACTTCTTATCA
    AGCACAGATCAAAATACATTGTATAGTATGAGATGGAATCCAAAAAATCCAGGAGAACAT
    CAATATGCTACAGATATTAAGTGGGCAGAAAGTAATGCAACAATTATCGCTGACTTTTAT
    AAGAACATGAAGACTGAAGGAAAATACTTCAAATACTTTGTGTATAAAGATGACAGTAAA
    CATTTGAATAAGTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    855

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_RS09355 [old locus tag: NWMN_1667 ]
  • symbol: NWMN_RS09355
  • description: autolysin
  • length: 284
  • theoretical pI: 9.78873
  • theoretical MW: 32505.8
  • GRAVY: -0.595423

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    flagellar rod assembly protein/muramidase FlgJ (TIGR02541; HMM-score: 14.8)
    Genetic information processingProtein synthesisTranslation factorsselenocysteine-specific translation elongation factor (TIGR00475; HMM-score: 13.5)
  • TheSEED:
  • PFAM:
    Lysozyme (CL0037) Glucosaminidase; Mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase (PF01832; HMM-score: 48.4)
    no clan definedPox_A3L; Poxvirus A3L Protein (PF05288; HMM-score: 14.1)
    Peptidase_MA (CL0126) Peptidase_M56; BlaR1 peptidase M56 (PF05569; HMM-score: 13.1)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Extracellular
    • Cytoplasmic Score: 0.01
    • Cytoplasmic Membrane Score: 0.09
    • Cellwall Score: 0.18
    • Extracellular Score: 9.72
    • Internal Helix: 1
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.224
    • Ymax_pos: 12
    • Cmax: 0.127
    • Cmax_pos: 33
    • Smax: 0.537
    • Smax_pos: 3
    • Smean: 0.493
    • D: 0.329
  • predicted transmembrane helices (TMHMM): 1

Accession numbers[edit source | edit]

  • GI: 446955577 NCBI
  • RefSeq: WP_001032833 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MNKHKKGSIFGIIGLVVIFAVVSFLFFSMISDQIFFKHVKSDIKIEKLNVTLNDAAKKQINNYTSQQVSNKKNDAWRDASATEIKSAMDSGTFIDNEKQKYQFLDLSKYQGIDKNRIKRMLVDRPTLLKHTDDFLKAAKDKHVNEVYLISHALLETGAVKSELANGVEIDGKKYYNFYGVGALDKDPIKTGAEYAKKHGWDTPEKAISGGADFIHKHFLSSTDQNTLYSMRWNPKNPGEHQYATDIKWAESNATIIADFYKNMKTEGKYFKYFVYKDDSKHLNK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • NWMN_RS09355 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]