From AureoWiki
Jump to navigation Jump to search

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS09915 [old locus tag: NWMN_tRNA32 ]
  • pan locus tag?: SAUPAN004808000
  • symbol: NWMN_RS09915
  • pan gene symbol?: trnaL
  • synonym:
  • product: tRNA-Phe

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: tRNA
  • locus tag: NWMN_RS09915 [old locus tag: NWMN_tRNA32 ]
  • symbol: NWMN_RS09915
  • product: tRNA-Phe
  • replicon: chromosome
  • strand: -
  • coordinates: 1956510..1956582
  • length: 73
  • essential: unknown

Accession numbers[edit | edit source]

  • Location: NC_009641 (1956510..1956582) NCBI
  • BioCyc:
  • MicrobesOnline: see NWMN_tRNA32

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    GGTTCAGTAGCTCAGTTGGTAGAGCAATGGATTGAAGCTCCATGTGTCGGCAGTTCGACT
    CTGTCCTGAACCA
    60
    73

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: NWMN_RS09915 [old locus tag: NWMN_tRNA32 ]
  • symbol: NWMN_RS09915
  • description: tRNA-Phe
  • length:
  • theoretical pI:
  • theoretical MW:
  • GRAVY:

Function[edit | edit source]

  • TIGRFAM:
  • TheSEED:
  • PFAM:

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb:
  • LocateP:
  • SignalP:
  • predicted transmembrane helices (TMHMM):

Accession numbers[edit | edit source]

  • GI:
  • RefSeq:
  • UniProt:

Protein sequence[edit | edit source]

Experimental data[edit | edit source]

  • experimentally validated:
  • protein localization:
  • quantitative data / protein copy number per cell:
  • interaction partners:

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]