From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS13035 [old locus tag: NWMN_2264 ]
  • pan locus tag?: SAUPAN005871000
  • symbol: NWMN_RS13035
  • pan gene symbol?: hssS
  • synonym:
  • product: two-component sensor histidine kinase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_RS13035 [old locus tag: NWMN_2264 ]
  • symbol: NWMN_RS13035
  • product: two-component sensor histidine kinase
  • replicon: chromosome
  • strand: +
  • coordinates: 2486491..2487864
  • length: 1374
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_009641 (2486491..2487864) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    ATGTTTAAAACACTCTATGCTAGAATTGCGATTTATTCCATTACGGTTATTTTATTTAGT
    GCATTAATAAGTTTTGTATTAACAAATGTTTACTATCATTATAATTTAAAAGCATCTAAT
    GACGCGAAAATCATGAAGACGCTTAAAGAAGCAAGACAATATGAACAATCAGCTAAACCA
    ACGCACATTCAACAATATTTCAAACATTTAGGGCAAATGAATTACCAAATAATGACCATT
    GATCAAAAAGGTCATAAGACATTTTATGGGGAGCCATTTAGAGAAGATACTTTATCACAA
    AATGCTATTAACAACGTATTAAATAATCAAGATTACCATGGTATTAAAGATAAACCATTC
    GCATTATTCGTAACTGGATTTTTCGACAATGTAACAGATAATACTGTTGGTATTAACTTT
    AAGACAAAAGACGGTTCAATAGCAGTATTTATGCGTCCAGATATTGGAGAAACATTTAGC
    GAGTTTAGAACATTCTTAGCCGTCTTGTTAATGTTGTTATTATTTATCTCGATTTCATTA
    GTTATCGCATCAACCTATTCAATCATTCGTCCAGTAAAAAAGTTAAAGCTAGCGACCGAA
    CGCTTAATTGATGGTGATTTTGAAACACCTATCAAACAAACACGCAAAGATGAAATTGGA
    ACATTACAGTATCACTTTAATAAGATGAGAGAGTCATTGGGACAAGTTGATCAAATGAGG
    CAGCATTTTGTACAAAATGTATCTCATGAAATCAAAACACCATTAACACATATTCATCAT
    TTATTAAGCGAGTTACAACAAACTTCTGATAAAACATTAAGACAACAATATATAAATGAT
    ATCTATACCATTACAACGCAGCTGAGCGGATTAACAACTGAATTGTTGCTCTTATCCGAA
    TTAGATAATCACCAACATTTATTATTCGATGATAAGATTCAAGTCAATCAACTCATTAAA
    GATATCATTCGACATGAACAATTTGCTGCTGATGAAAAGTCGTTAATCATTTTAGCTGAC
    CTAGAATCAATCAATTTCCTAGGAAATCAACGTTTGTTACATCAAGCATTGAGTAATTTA
    TTAATAAATGCTATTAAGTATACAGATGTTGGTGGTGCCATTGACATCGCTTTGCAACAT
    AGTCACAACAATATCATTTTCACAATAAGTAATGATGGTTCACCAATTAGTCCACAAGCT
    GAAGCACGTTTATTTGAACGTTTTTATAAAGTGAGCAAACATGATAATAGCAATGGTTTA
    GGTCTTGCAATTACAAAATCCATCATTGAATTGCATCATGGTACAATCCAATTCACACAA
    AGTAACGAGTATGTAACCACCTTTACTATTACACTGCCAAATAATTCACTTTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1374

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_RS13035 [old locus tag: NWMN_2264 ]
  • symbol: NWMN_RS13035
  • description: two-component sensor histidine kinase
  • length: 457
  • theoretical pI: 7.2453
  • theoretical MW: 52374.5
  • GRAVY: -0.181838

Function[edit source | edit]

  • reaction:
    EC 2.7.13.3?  ExPASy
    Histidine kinaseATP + protein L-histidine = ADP + protein N-phospho-L-histidine
  • TIGRFAM:
    Signal transductionSignal transductionTwo-component systemsphosphate regulon sensor kinase PhoR (TIGR02966; EC 2.7.3.-; HMM-score: 158.1)
    heavy metal sensor kinase (TIGR01386; EC 2.7.13.3; HMM-score: 151.2)
    proteobacterial dedicated sortase system histidine kinase (TIGR03785; HMM-score: 106.5)
    Signal transductionSignal transductionTwo-component systemsTMAO reductase sytem sensor TorS (TIGR02956; EC 2.7.13.3; HMM-score: 86.8)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingputative PEP-CTERM system histidine kinase (TIGR02916; EC 2.7.13.3; HMM-score: 47.9)
    Signal transductionSignal transductionTwo-component systemsputative PEP-CTERM system histidine kinase (TIGR02916; EC 2.7.13.3; HMM-score: 47.9)
    MetabolismCentral intermediary metabolismNitrogen fixationnitrogen fixation negative regulator NifL (TIGR02938; HMM-score: 19.1)
    Signal transductionRegulatory functionsProtein interactionsnitrogen fixation negative regulator NifL (TIGR02938; HMM-score: 19.1)
  • TheSEED:
  • PFAM:
    His_Kinase_A (CL0025) HATPase_c; Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase (PF02518; HMM-score: 71)
    no clan definedHAMP; HAMP domain (PF00672; HMM-score: 36.2)
    His_Kinase_A (CL0025) HisKA; His Kinase A (phospho-acceptor) domain (PF00512; HMM-score: 33.6)
    HATPase_c_5; GHKL domain (PF14501; HMM-score: 28.3)
    HATPase_c_2; Histidine kinase-like ATPase domain (PF13581; HMM-score: 15)
    no clan definedSigma_reg_N; Sigma factor regulator N-terminal (PF13800; HMM-score: 14.4)
    Blo-t-5; Mite allergen Blo t 5 (PF11642; HMM-score: 14.1)
    DUF4199; Protein of unknown function (DUF4199) (PF13858; HMM-score: 11.6)
    SAPIS-gp6; Pathogenicity island protein gp6 in Staphylococcus (PF16722; HMM-score: 9.5)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.01
    • Cytoplasmic Membrane Score: 9.99
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 2
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.202
    • Ymax_pos: 14
    • Cmax: 0.201
    • Cmax_pos: 33
    • Smax: 0.475
    • Smax_pos: 13
    • Smean: 0.411
    • D: 0.284
  • predicted transmembrane helices (TMHMM): 2

Accession numbers[edit source | edit]

  • GI: 446399474 NCBI
  • RefSeq: WP_000477329 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MFKTLYARIAIYSITVILFSALISFVLTNVYYHYNLKASNDAKIMKTLKEARQYEQSAKPTHIQQYFKHLGQMNYQIMTIDQKGHKTFYGEPFREDTLSQNAINNVLNNQDYHGIKDKPFALFVTGFFDNVTDNTVGINFKTKDGSIAVFMRPDIGETFSEFRTFLAVLLMLLLFISISLVIASTYSIIRPVKKLKLATERLIDGDFETPIKQTRKDEIGTLQYHFNKMRESLGQVDQMRQHFVQNVSHEIKTPLTHIHHLLSELQQTSDKTLRQQYINDIYTITTQLSGLTTELLLLSELDNHQHLLFDDKIQVNQLIKDIIRHEQFAADEKSLIILADLESINFLGNQRLLHQALSNLLINAIKYTDVGGAIDIALQHSHNNIIFTISNDGSPISPQAEARLFERFYKVSKHDNSNGLGLAITKSIIELHHGTIQFTQSNEYVTTFTITLPNNSL

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • NWMN_RS13035 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]