From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS13225 [old locus tag: NWMN_2300 ]
  • pan locus tag?: SAUPAN005932000
  • symbol: NWMN_RS13225
  • pan gene symbol?: nasD
  • synonym:
  • product: nitrite reductase large subunit

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_RS13225 [old locus tag: NWMN_2300 ]
  • symbol: NWMN_RS13225
  • product: nitrite reductase large subunit
  • replicon: chromosome
  • strand: -
  • coordinates: 2527008..2529413
  • length: 2406
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_009641 (2527008..2529413) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    1861
    1921
    1981
    2041
    2101
    2161
    2221
    2281
    2341
    2401
    ATGGCAAAGCAAAAACTAGTAATGATTGGTAACGGTATGGCGGGCATTCGAACAATCGAA
    GAAATATTAGAGCGCGCCAACGATTTATATGATATTACGGTAATAGGTAAAGAACCTTAT
    CCAAACTATAACCGCATCATGCTTTCAAATATTTTACAAAATAAAATGACAGTTGAAGAA
    ACAATTATGAATCCATATGAGTGGTATGAGGAACATGGTATCGAGTTAATTACAAATGAT
    CCTGTAATTGAAGTAGATAGAGCAAATCAATCAGTTACTACTGCAAATGGTATTGAAGTA
    TCATACGATAAATTGATTTTTGCGACAGGTTCTAAAGCATTCGTCATTCCAGTTCCAGGT
    TCGACATTACCGAGTGTAATTGGTTGGAGAACGATTGATGATACTGAACAAATGATGAAC
    ATTGCTAAGACTAAAAAGAAAGCAATTGTAATTGGTGGAGGATTACTAGGTTTAGAGTGT
    GCACGTGGTTTATTAGATCAAGGTATGGAAGTAACGGTGTTACATTTAGCTGAATGGTTG
    ATGGAAATGCAACTAGACCGTAAAGCTGGAAATATGCTTAAAGCAGATCTAGAAAAGCAA
    GGTATGAAGTTTGAAATGCAAGCCAACACAACTGAAATCTTAGGAGAAGATGATGTTGAG
    GGTGTTAAATTGGCTGATGGACGCGAGATTCCGGCAGACTTAGTTGTTATGGCAGTAGGT
    ATACGACCATACACAGAAGTAGCCAAAGAATCAGGTCTAGATGTTAATCGTGGTATTGTT
    GTCAATGATGTGATGCAAACAAGTGATAGCAATGTATATGCAGTTGGTGAATGTGCAGAA
    CATAACGGCAAAGTTTATGGACTCGTTGCACCACTATATGAACAAGGTAAAGTATTAGCT
    GATCATTTAACAAATAAAGAAACGAACGGATACAAGGGATCAACAACATTTACGTCATTA
    AAAGTTTCTGGGTGTGACTTGTATAGTGCTGGTCAAATTGTAGAAAATGCAGAAATTAAA
    GGTATTGAAATATTTAATAGTGTTGATAATAACTATAAAAAAATCTTTTTAAAAGACGGT
    AATGTAGTTGGTGCAGTACTATATGGTGATATCGATGATGGTTCACGCTTTTATAACATG
    ATGAAAAAAGGTGAATCCACTGAAGATTACACACTTGTATCATTGCTTACTAAAGGTGGA
    GAAGAGGCATCGCTATCAATTGCTGATATGGCTGATGATGAAACAATTTGTGGTTGTAAT
    GGTGTTGATAAAGGTACTATAGTAAATGCGATTACGGAAAATGGCTTTACAACAGTTGAA
    GAAGTAACGGCTAAAACAAAAGCGGGGAATTCATGTGGTAAATGTAAACCGCAAATTGCT
    CAAATATTGCAGCACACCTTAGGAGATGACTTTGTTGCCGCAAAACCTGCTGGTATATGT
    GGTTGTACTGATTTGACACGCGATCAAATAGTAACGCAAATAAGAGCGAAAGGTTTAAAA
    ACATCTAAAGAAGTTCGACATGTTTTAAACTTTAAAAATAAAGGTGGATGTCCAAAATGT
    CGACCAGCAATCAACTATTATTTAAACATGGTTTATCCACATGATCATGAAGATGAAAGA
    GAATCAAGATTTGCTAACGAACGTTACCATGCGAATATTCAAAATGATGGTACATTTTCT
    GTTATACCTCAAATGCGTGGGGGTGTTACAGATGCAGACCAACTGATTCGTCTAGGAGAA
    GTGGCTAAGAAATATCATGTGCCACTAGTTAAAGTGACAGGTTCACAACGTGTTGGTTTG
    TATGGAGTTAAAAAAGAAGAATTACCAAATATATGGGAAGACCTAGGTATGCGTTCAGCA
    TCAGCTTATGGTAAGAAAACACGCTCAGTTAAAAGCTGTGTTGGTAAAGAGTTTTGTCGA
    TTTGGTACGCAATACACGACACGACTTGGCATTCGTTTAGAAAAAACATTTGAATACATC
    GATACACCTCATAAATTCAAAATGGGTGTATCAGGCTGCCCAAGAAGTTGTGTTGAATCA
    GGTGTTAAAGATTTTGGTATTATCTCAGTTGAAAATGGATTCCAAATCTATATCGGTGGT
    AATGGTGGTACAGAAGTTGAAAAAGCTGAATTTTTAACAACTGTAGAAACAGAAGATGAA
    GTAATCAAATTATGTGGTGCTTTGATGCAATATTATCGCGAAACAGGTATATATGCTGAA
    AGAACAGCGCCATGGTTAAGAAGACTTGGATTTGAAAATGTAAAAGAAGTCTTACTTGAC
    CCAGAAAGACAAAATGAACTATTTGAACGCATTATGGATGCTAAAAAAGCAGTCGAAGCT
    GAACCTTGGGAAGCAATAACTAGCAATGCGCAAGCACGTAGAATTTTTGAAGTGGAGAAG
    GTGTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1860
    1920
    1980
    2040
    2100
    2160
    2220
    2280
    2340
    2400
    2406

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_RS13225 [old locus tag: NWMN_2300 ]
  • symbol: NWMN_RS13225
  • description: nitrite reductase large subunit
  • length: 801
  • theoretical pI: 4.99932
  • theoretical MW: 88656.5
  • GRAVY: -0.313233

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    MetabolismCentral intermediary metabolismNitrogen metabolismnitrite reductase [NAD(P)H], large subunit (TIGR02374; EC 1.7.1.4; HMM-score: 931.1)
    Cellular processesCellular processesDetoxificationCoA-disulfide reductase (TIGR03385; EC 1.8.1.14; HMM-score: 143)
    dihydrolipoyl dehydrogenase (TIGR01350; EC 1.8.1.4; HMM-score: 101.3)
    Cellular processesCellular processesDetoxificationmercury(II) reductase (TIGR02053; EC 1.16.1.1; HMM-score: 80.3)
    pyridine nucleotide-disulfide oxidoreductase family protein (TIGR03169; HMM-score: 68)
    mycothione reductase (TIGR03452; EC 1.8.1.15; HMM-score: 57.4)
    MetabolismEnergy metabolismElectron transportglutathione-disulfide reductase (TIGR01424; EC 1.8.1.7; HMM-score: 56.4)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOtherFe-S cluster assembly protein NifU (TIGR02000; HMM-score: 53.1)
    MetabolismCentral intermediary metabolismNitrogen fixationFe-S cluster assembly protein NifU (TIGR02000; HMM-score: 53.1)
    MetabolismEnergy metabolismElectron transportthioredoxin-disulfide reductase (TIGR01292; EC 1.8.1.9; HMM-score: 50.6)
    MetabolismCentral intermediary metabolismSulfur metabolismsulfite reductase, subunit C (TIGR02912; EC 1.8.-.-; HMM-score: 48.2)
    MetabolismCentral intermediary metabolismSulfur metabolismsulfite reductase, dissimilatory-type alpha subunit (TIGR02064; EC 1.8.99.3; HMM-score: 48)
    thioredoxin and glutathione reductase (TIGR01438; EC 1.6.4.-; HMM-score: 47.5)
    MetabolismAmino acid biosynthesisGlutamate familyglutamate synthase (NADPH), homotetrameric (TIGR01316; EC 1.4.1.13; HMM-score: 34)
    MetabolismCentral intermediary metabolismSulfur metabolismsulfite reductase, ferredoxin dependent (TIGR02042; EC 1.8.7.1; HMM-score: 32.9)
    Unknown functionEnzymes of unknown specificityputative bacillithiol system oxidoreductase, YpdA family (TIGR04018; EC 1.8.-.-; HMM-score: 31.5)
    Unknown functionEnzymes of unknown specificityflavoprotein, HI0933 family (TIGR00275; HMM-score: 26.2)
    MetabolismCentral intermediary metabolismSulfur metabolismsulfite reductase (NADPH) hemoprotein, beta-component (TIGR02041; EC 1.8.1.2; HMM-score: 25)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersHeme, porphyrin, and cobalaminprecorrin-3B synthase (TIGR02435; EC 1.14.13.83; HMM-score: 23.5)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersThiamineglycine oxidase ThiO (TIGR02352; EC 1.4.3.19; HMM-score: 22.9)
    squalene-associated FAD-dependent desaturase (TIGR03467; HMM-score: 21.4)
    glutamate synthase, small subunit (TIGR01318; HMM-score: 20.1)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA U-34 5-methylaminomethyl-2-thiouridine biosynthesis protein MnmC, C-terminal domain (TIGR03197; HMM-score: 18.7)
    putative selenate reductase, YgfK subunit (TIGR03315; HMM-score: 18.4)
    oxidoreductase/SelD-related fusion protein (TIGR04369; HMM-score: 17.6)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMenaquinone and ubiquinoneubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6 family (TIGR01988; EC 1.14.13.-; HMM-score: 17.3)
    glutamate synthase, NADH/NADPH, small subunit (TIGR01317; EC 1.4.1.-; HMM-score: 16.8)
    mycofactocin system FadH/OYE family oxidoreductase 2 (TIGR03997; EC 1.-.-.-; HMM-score: 15.4)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOtherphytoene desaturase (TIGR02734; EC 1.14.99.-; HMM-score: 14.7)
    lycopene cyclase family protein (TIGR01790; HMM-score: 14.4)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOthercarotene isomerase (TIGR02730; EC 5.-.-.-; HMM-score: 13.8)
    MetabolismEnergy metabolismAnaerobicglycerol-3-phosphate dehydrogenase, anaerobic, A subunit (TIGR03377; EC 1.1.5.3; HMM-score: 13.4)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMenaquinone and ubiquinone2-polyprenyl-6-methoxyphenol 4-hydroxylase (TIGR01984; EC 1.14.13.-; HMM-score: 13.3)
    FAD dependent oxidoreductase TIGR03364 (TIGR03364; HMM-score: 13)
    mycofactocin system FadH/OYE family oxidoreductase 1 (TIGR03996; EC 1.-.-.-; HMM-score: 11.7)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersChlorophyll and bacteriochlorphyllgeranylgeranyl reductase family (TIGR02032; EC 1.3.1.-; HMM-score: 10.9)
  • TheSEED:
  • PFAM:
    NADP_Rossmann (CL0063) Pyr_redox_2; Pyridine nucleotide-disulphide oxidoreductase (PF07992; HMM-score: 193.6)
    no clan definedFer2_BFD; BFD-like [2Fe-2S] binding domain (PF04324; HMM-score: 109.8)
    NIR_SIR; Nitrite and sulphite reductase 4Fe-4S domain (PF01077; HMM-score: 89.8)
    NADP_Rossmann (CL0063) Pyr_redox; Pyridine nucleotide-disulphide oxidoreductase (PF00070; HMM-score: 66.1)
    no clan definedNIR_SIR_ferr; Nitrite/Sulfite reductase ferredoxin-like half domain (PF03460; HMM-score: 43.4)
    NADP_Rossmann (CL0063) Pyr_redox_3; Pyridine nucleotide-disulphide oxidoreductase (PF13738; HMM-score: 40.6)
    NAD_binding_7; Putative NAD(P)-binding (PF13241; HMM-score: 27.9)
    HI0933_like; HI0933-like protein (PF03486; HMM-score: 25.5)
    NAD_binding_9; FAD-NAD(P)-binding (PF13454; HMM-score: 24.5)
    DAO; FAD dependent oxidoreductase (PF01266; HMM-score: 22.6)
    GIDA; Glucose inhibited division protein A (PF01134; HMM-score: 16.2)
    Amino_oxidase; Flavin containing amine oxidoreductase (PF01593; HMM-score: 15.8)
    3HCDH_N; 3-hydroxyacyl-CoA dehydrogenase, NAD binding domain (PF02737; HMM-score: 14.9)
    NAD_binding_8; NAD(P)-binding Rossmann-like domain (PF13450; HMM-score: 14)
    FAD_binding_2; FAD binding domain (PF00890; HMM-score: 12.4)
    Lycopene_cycl; Lycopene cyclase protein (PF05834; HMM-score: 11.6)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.131
    • Ymax_pos: 11
    • Cmax: 0.111
    • Cmax_pos: 26
    • Smax: 0.235
    • Smax_pos: 2
    • Smean: 0.161
    • D: 0.143
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 447041470 NCBI
  • RefSeq: WP_001118726 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MAKQKLVMIGNGMAGIRTIEEILERANDLYDITVIGKEPYPNYNRIMLSNILQNKMTVEETIMNPYEWYEEHGIELITNDPVIEVDRANQSVTTANGIEVSYDKLIFATGSKAFVIPVPGSTLPSVIGWRTIDDTEQMMNIAKTKKKAIVIGGGLLGLECARGLLDQGMEVTVLHLAEWLMEMQLDRKAGNMLKADLEKQGMKFEMQANTTEILGEDDVEGVKLADGREIPADLVVMAVGIRPYTEVAKESGLDVNRGIVVNDVMQTSDSNVYAVGECAEHNGKVYGLVAPLYEQGKVLADHLTNKETNGYKGSTTFTSLKVSGCDLYSAGQIVENAEIKGIEIFNSVDNNYKKIFLKDGNVVGAVLYGDIDDGSRFYNMMKKGESTEDYTLVSLLTKGGEEASLSIADMADDETICGCNGVDKGTIVNAITENGFTTVEEVTAKTKAGNSCGKCKPQIAQILQHTLGDDFVAAKPAGICGCTDLTRDQIVTQIRAKGLKTSKEVRHVLNFKNKGGCPKCRPAINYYLNMVYPHDHEDERESRFANERYHANIQNDGTFSVIPQMRGGVTDADQLIRLGEVAKKYHVPLVKVTGSQRVGLYGVKKEELPNIWEDLGMRSASAYGKKTRSVKSCVGKEFCRFGTQYTTRLGIRLEKTFEYIDTPHKFKMGVSGCPRSCVESGVKDFGIISVENGFQIYIGGNGGTEVEKAEFLTTVETEDEVIKLCGALMQYYRETGIYAERTAPWLRRLGFENVKEVLLDPERQNELFERIMDAKKAVEAEPWEAITSNAQARRIFEVEKV

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • NWMN_RS13225 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]