From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS13825 [old locus tag: NWMN_2404 ]
  • pan locus tag?: SAUPAN006133000
  • symbol: NWMN_RS13825
  • pan gene symbol?:
  • synonym:
  • product: MerR family transcriptional regulator

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_RS13825 [old locus tag: NWMN_2404 ]
  • symbol: NWMN_RS13825
  • product: MerR family transcriptional regulator
  • replicon: chromosome
  • strand: -
  • coordinates: 2646197..2646961
  • length: 765
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_009641 (2646197..2646961) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    ATGTCTAACTATTCGACTGGAGAACTCGCAAAATTATGCAATGTGACAACACGAACGATT
    CAATATTATGATCGCAAAGGTATTTTGAAACCACAAGGATTTACAGAAGGAAAGCGTCGT
    GTGTATACAGAACAACAGCGACAAACATTAGAGTTAATCTTATTGCTTAAAGATTTAGGT
    TGTGCGTTAAGCGATATAGATATGTTGCTAAAAGGTGAAGGTACTTTGAAGACGCTCAAT
    ACTTTACTAACTATGAAACAACAAGAAATTAACCAACAAGTTAAACAGCAACAAGCGGTA
    TTAAACAAAATTAAAAATGTTCAATATTACGTAAATGAAGCGTCGACGTCTCCAATCACA
    CACTTAAAAGACATAGAGCATGTCATGAGTAAATCAGCTGAAATGAAAAGTATTCGTCGT
    AACATTTGGATTAGTGCTGGTATTATAGGAATAATTCAATATTCTAGCATTATAAGTGCA
    ATTTTGATGAAAAATAAATGGCCGTTTTTAATTGCTTTACCATTTATGATTGGTTATGGC
    ATTGGTGTTACTTTTTATTACCAACAAAAGGTTGCCTATTTATGTCCTAACTGCCAGCAT
    ATATTCTCACCATCTTTGTGGGCAGTTATCAAAGCGAAACATACAGCGACAACACGTCGA
    TTCGAATGTCCAAACTGTCATGAAACGCATTATTGCATTGAAGTACCTAAAGCGCATATG
    AGTACAGAACAATTAGAAATATCCCACATACAACATAACAATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    765

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_RS13825 [old locus tag: NWMN_2404 ]
  • symbol: NWMN_RS13825
  • description: MerR family transcriptional regulator
  • length: 254
  • theoretical pI: 9.42155
  • theoretical MW: 29141.8
  • GRAVY: -0.238189

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Signal transductionRegulatory functionsDNA interactionsZn(II)-responsive transcriptional regulator (TIGR02043; HMM-score: 59)
    Cellular processesCellular processesDetoxificationHg(II)-responsive transcriptional regulator (TIGR02051; HMM-score: 44.9)
    Signal transductionRegulatory functionsDNA interactionsHg(II)-responsive transcriptional regulator (TIGR02051; HMM-score: 44.9)
    Signal transductionRegulatory functionsDNA interactionsCd(II)/Pb(II)-responsive transcriptional regulator (TIGR02047; HMM-score: 44.5)
    Signal transductionRegulatory functionsDNA interactionsCu(I)-responsive transcriptional regulator (TIGR02044; HMM-score: 40.5)
    Cellular processesCellular processesDetoxificationredox-sensitive transcriptional activator SoxR (TIGR01950; HMM-score: 19.6)
    Signal transductionRegulatory functionsDNA interactionsredox-sensitive transcriptional activator SoxR (TIGR01950; HMM-score: 19.6)
    cxxc_20_cxxc protein (TIGR04104; HMM-score: 16.1)
    MJ0042 family finger-like domain (TIGR02098; HMM-score: 5.7)
  • TheSEED:
  • PFAM:
    HTH (CL0123) MerR_1; MerR HTH family regulatory protein (PF13411; HMM-score: 61.4)
    MerR; MerR family regulatory protein (PF00376; HMM-score: 41.4)
    MerR-DNA-bind; MerR, DNA binding (PF09278; HMM-score: 18.8)
    HTH_17; Helix-turn-helix domain (PF12728; HMM-score: 17.6)
    C1 (CL0006) C1_4; TFIIH C1-like domain (PF07975; HMM-score: 17)
    Zn_Beta_Ribbon (CL0167) Zn-ribbon_8; Zinc ribbon domain (PF09723; HMM-score: 14.9)
    DUF4379; Probable zinc-ribbon domain (PF14311; HMM-score: 14)
    MFS (CL0015) UNC-93; Ion channel regulatory protein UNC-93 (PF05978; HMM-score: 13.7)
    Zn_Beta_Ribbon (CL0167) zinc_ribbon_4; zinc-ribbon domain (PF13717; HMM-score: 13.1)
    OrfB_Zn_ribbon; Putative transposase DNA-binding domain (PF07282; HMM-score: 13)
    TRASH (CL0175) zf-MYND; MYND finger (PF01753; HMM-score: 12.1)
    C2H2-zf (CL0361) zf-Di19; Drought induced 19 protein (Di19), zinc-binding (PF05605; HMM-score: 11.7)
    Zn_Beta_Ribbon (CL0167) zinc_ribbon_10; Predicted integral membrane zinc-ribbon metal-binding protein (PF10058; HMM-score: 10.9)
    DUF1610; Domain of unknown function (DUF1610) (PF07754; HMM-score: 10.8)
    Nudix_N_2; Nudix N-terminal (PF14803; HMM-score: 10.7)
    C2H2-zf (CL0361) zf-H2C2_2; Zinc-finger double domain (PF13465; HMM-score: 9.5)
    no clan definedHypA; Hydrogenase/urease nickel incorporation, metallochaperone, hypA (PF01155; HMM-score: 9.4)
    SlyX; SlyX (PF04102; HMM-score: 9.3)
    Zn_Beta_Ribbon (CL0167) CpXC; CpXC protein (PF14353; HMM-score: 9.2)
    Zn_Tnp_IS1595; Transposase zinc-ribbon domain (PF12760; HMM-score: 6.9)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 2
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.12
    • Ymax_pos: 11
    • Cmax: 0.112
    • Cmax_pos: 23
    • Smax: 0.242
    • Smax_pos: 3
    • Smean: 0.124
    • D: 0.121
  • predicted transmembrane helices (TMHMM): 2

Accession numbers[edit source | edit]

  • GI: 445996152 NCBI
  • RefSeq: WP_000074007 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MSNYSTGELAKLCNVTTRTIQYYDRKGILKPQGFTEGKRRVYTEQQRQTLELILLLKDLGCALSDIDMLLKGEGTLKTLNTLLTMKQQEINQQVKQQQAVLNKIKNVQYYVNEASTSPITHLKDIEHVMSKSAEMKSIRRNIWISAGIIGIIQYSSIISAILMKNKWPFLIALPFMIGYGIGVTFYYQQKVAYLCPNCQHIFSPSLWAVIKAKHTATTRRFECPNCHETHYCIEVPKAHMSTEQLEISHIQHNN

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • NWMN_RS13825 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]