From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS14225 [old locus tag: NWMN_2477 ]
  • pan locus tag?: SAUPAN006252000
  • symbol: NWMN_RS14225
  • pan gene symbol?:
  • synonym:
  • product: TetR family transcriptional regulator

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_RS14225 [old locus tag: NWMN_2477 ]
  • symbol: NWMN_RS14225
  • product: TetR family transcriptional regulator
  • replicon: chromosome
  • strand: +
  • coordinates: 2724473..2725030
  • length: 558
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_009641 (2724473..2725030) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    ATGCGAAAAGATGCAAAAGAGAATAGGCAACGAATTGAAGAAATAGCGCACAAACTTTTT
    GATGAAGAAGGCGTTGAAAACATTAGTATGAATCGTATTGCTAAAGAACTAGGTATCGGT
    ATGGGGACATTGTATCGACATTTCAAAGATAAAAGCGATTTATGCTACTACGTCATACAA
    AGAGACCTTGATATTTTTATCACTCATTTTAAGCAAATTAAAGATGACTATCATTCTAAT
    TATGAGGTTATGCAAGTGTCGTTAGATTATCTTTTACAATTTAAAATCGATAATAAGGCA
    CTACTGCAATGTATTGAAGCAGGCAACAATAAATTACGTTTTTACCAAAGCGCATTTTAT
    CAAGAATTATTTGATTTTTATTATGACTTATTTAAAAGCGATGACGACACTTACACGAAG
    TTCAAAACAGATATGCTGTTGCAATCATTATCAACTAGTGTATTTGCCTTCCAAATAGAG
    CATCGCCATATTTCAATTGAAGCGTACAGAAATTATTTATTAAACATTTATTTAGATGAG
    GTGGGACGTAATGACTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    558

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_RS14225 [old locus tag: NWMN_2477 ]
  • symbol: NWMN_RS14225
  • description: TetR family transcriptional regulator
  • length: 185
  • theoretical pI: 5.33099
  • theoretical MW: 22260
  • GRAVY: -0.54

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Signal transductionRegulatory functionsDNA interactionsmycofactocin system transcriptional regulator (TIGR03968; HMM-score: 41.8)
    pyrimidine utilization regulatory protein R (TIGR03613; HMM-score: 20.7)
    probable dihydroxyacetone kinase regulator (TIGR02366; HMM-score: 20.6)
    Signal transductionRegulatory functionsDNA interactionstranscriptional repressor BetI (TIGR03384; HMM-score: 16)
    probable regulatory domain (TIGR03879; HMM-score: 13.5)
    Genetic information processingMobile and extrachromosomal element functionsOtherprobable addiction module antidote protein (TIGR02684; HMM-score: 12.6)
  • TheSEED:
  • PFAM:
    HTH (CL0123) TetR_N; Bacterial regulatory proteins, tetR family (PF00440; HMM-score: 46.6)
    CENP-B_N; CENP-B N-terminal DNA-binding domain (PF04218; HMM-score: 16.2)
    HTH_Tnp_1_2; Helix-turn-helix of insertion element transposase (PF13022; HMM-score: 14.6)
    HTH_7; Helix-turn-helix domain of resolvase (PF02796; HMM-score: 13.7)
    no clan definedTnsD; Tn7-like transposition protein D (PF15978; HMM-score: 12.7)
    NPIP; Nuclear pore complex interacting protein (NPIP) (PF06409; HMM-score: 12.3)
    HTH (CL0123) HTH_23; Homeodomain-like domain (PF13384; HMM-score: 12.1)
    4H_Cytokine (CL0053) IL12; Interleukin-12 alpha subunit (PF03039; HMM-score: 11.7)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.103
    • Ymax_pos: 11
    • Cmax: 0.105
    • Cmax_pos: 35
    • Smax: 0.175
    • Smax_pos: 2
    • Smean: 0.094
    • D: 0.099
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 447146932 NCBI
  • RefSeq: WP_001224188 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MRKDAKENRQRIEEIAHKLFDEEGVENISMNRIAKELGIGMGTLYRHFKDKSDLCYYVIQRDLDIFITHFKQIKDDYHSNYEVMQVSLDYLLQFKIDNKALLQCIEAGNNKLRFYQSAFYQELFDFYYDLFKSDDDTYTKFKTDMLLQSLSTSVFAFQIEHRHISIEAYRNYLLNIYLDEVGRND

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • NWMN_RS14225 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]