From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS14320 [old locus tag: NWMN_2495 ]
  • pan locus tag?: SAUPAN006292000
  • symbol: NWMN_RS14320
  • pan gene symbol?: panC
  • synonym:
  • product: pantoate--beta-alanine ligase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_RS14320 [old locus tag: NWMN_2495 ]
  • symbol: NWMN_RS14320
  • product: pantoate--beta-alanine ligase
  • replicon: chromosome
  • strand: -
  • coordinates: 2740167..2741018
  • length: 852
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_009641 (2740167..2741018) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    ATGACTAAGCTGATTACTACGGTAAAAGAGATGCAACACATTGTTAAAGCAGCCAAACGC
    TCAGGCACAACGATTGGTTTTATCCCAACAATGGGTGCCTTACATGATGGACATTTAACG
    ATGGTACGCGAATCAGTTAGTACAAATGATATTACAATTGTGAGTGTATTTGTTAATCCA
    TTACAATTTGGTCCAAACGAAGATTTCGATGCTTATCCGAGACAAATTGATAAAGATTTA
    GAATTAGTATCAGAAGTAGGAGCGGACATTGTTTTTCATCCTGCAGTAGAAGATATGTAT
    CCAGGTGAATTAGGTATTGATGTCAAAGTAGGCCCATTAGCTGATGTGTTAGAAGGAGCG
    AAGCGTCCAGGGCATTTTGATGGGGTGGTAACAGTAGTTAATAAGCTATTTAATATTGTT
    ATGCCGGATTATGCTTATTTTGGTAAAAAAGATGCCCAGCAATTGGCTATTGTCGAGCAA
    ATGGTAAAAGACTTCAATCATGCCGTTGAAATTATTGGTATTGATATCGTTCGAGAAGCA
    GATGGTTTGGCGAAAAGTTCAAGAAATGTTTATTTAACGGAGCAAGAACGACAAGAAGCG
    GTACATTTAAGTAAAAGTTTGCTATTAGCACAAGCGTTGTATCAAGACGGTGAACGTCAA
    AGTAAAGTAATTATAGACAGGGTTACTGAATATCTTGAATCACATATAAGTGGACGCATT
    GAAGAAGTTGCTGTTTATAGTTATCCTCAATTAGTAGAACAACACGAAATAACTGGACGC
    ATATTTATCTCGTTAGCTGTTAAATTTTCAAAAGCGCGTTTAATAGATAATATAATAATT
    GGAGCTGAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    852

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_RS14320 [old locus tag: NWMN_2495 ]
  • symbol: NWMN_RS14320
  • description: pantoate--beta-alanine ligase
  • length: 283
  • theoretical pI: 4.95781
  • theoretical MW: 31461.8
  • GRAVY: -0.0208481

Function[edit source | edit]

  • reaction:
    EC 6.3.2.1?  ExPASy
    Pantoate--beta-alanine ligase (AMP-forming)ATP + (R)-pantoate + beta-alanine = AMP + diphosphate + (R)-pantothenate
  • TIGRFAM:
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersPantothenate and coenzyme Apantoate--beta-alanine ligase (TIGR00018; EC 6.3.2.1; HMM-score: 345.7)
    cytidyltransferase-like domain (TIGR00125; HMM-score: 28.1)
  • TheSEED:
  • PFAM:
    HUP (CL0039) Pantoate_ligase; Pantoate-beta-alanine ligase (PF02569; HMM-score: 329.1)
    Pec_lyase-like (CL0268) Haemagg_act; haemagglutination activity domain (PF05860; HMM-score: 12.3)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.242
    • Ymax_pos: 18
    • Cmax: 0.134
    • Cmax_pos: 18
    • Smax: 0.553
    • Smax_pos: 11
    • Smean: 0.382
    • D: 0.297
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446085880 NCBI
  • RefSeq: WP_000163735 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MTKLITTVKEMQHIVKAAKRSGTTIGFIPTMGALHDGHLTMVRESVSTNDITIVSVFVNPLQFGPNEDFDAYPRQIDKDLELVSEVGADIVFHPAVEDMYPGELGIDVKVGPLADVLEGAKRPGHFDGVVTVVNKLFNIVMPDYAYFGKKDAQQLAIVEQMVKDFNHAVEIIGIDIVREADGLAKSSRNVYLTEQERQEAVHLSKSLLLAQALYQDGERQSKVIIDRVTEYLESHISGRIEEVAVYSYPQLVEQHEITGRIFISLAVKFSKARLIDNIIIGAE

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • NWMN_RS14320 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]