From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS14570 [old locus tag: NWMN_2535 ]
  • pan locus tag?: SAUPAN006366000
  • symbol: NWMN_RS14570
  • pan gene symbol?: argR
  • synonym:
  • product: ArgR family transcriptional regulator

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_RS14570 [old locus tag: NWMN_2535 ]
  • symbol: NWMN_RS14570
  • product: ArgR family transcriptional regulator
  • replicon: chromosome
  • strand: -
  • coordinates: 2789451..2789900
  • length: 450
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_009641 (2789451..2789900) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    ATGAAGAAAAGTAAACGATTAGAAATTGTTTCTACAATAGTTAAAAAGCATAAGATTTAT
    AAAAAAGAACAAATCATTTCATATATTGAAGAATATTTTGGTGTAAGATATAGTGCAACA
    ACAATTGCTAAAGACTTGAAGGAACTAAATATATATCGTGTCCCTATCGATTGTGAGACA
    TGGATTTATAAAGCTATTAATAATCAAACAGAACAAGAGATGAGAGAAAAGTTTAGACAC
    TATTGTGAACATGAAGTTCTAAGTTCAATCATCAATGGTTCATACATTATCGTCAAAACC
    TCACCTGGTTTCGCCCAAGGCATAAACTATTTTATCGATCAGCTAAATATAGAAGAGATA
    TTAGGTACGGTGAGTGGAAATGACACTACATTAATCTTAACTGCCTCAAATGATATGGCA
    GAATACGTATATGCAAAATTATTTAAATAG
    60
    120
    180
    240
    300
    360
    420
    450

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_RS14570 [old locus tag: NWMN_2535 ]
  • symbol: NWMN_RS14570
  • description: ArgR family transcriptional regulator
  • length: 149
  • theoretical pI: 8.1664
  • theoretical MW: 17376.9
  • GRAVY: -0.290604

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    MetabolismAmino acid biosynthesisGlutamate familyarginine repressor (TIGR01529; HMM-score: 84.3)
    Signal transductionRegulatory functionsDNA interactionsarginine repressor (TIGR01529; HMM-score: 84.3)
  • TheSEED:
  • PFAM:
    no clan definedArg_repressor_C; Arginine repressor, C-terminal domain (PF02863; HMM-score: 64.6)
    HTH (CL0123) Arg_repressor; Arginine repressor, DNA binding domain (PF01316; HMM-score: 32.5)
    HTH_33; Winged helix-turn helix (PF13592; HMM-score: 14.3)
    no clan definedSapB_1; Saposin-like type B, region 1 (PF05184; HMM-score: 12.6)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.175
    • Ymax_pos: 11
    • Cmax: 0.106
    • Cmax_pos: 23
    • Smax: 0.438
    • Smax_pos: 1
    • Smean: 0.271
    • D: 0.212
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446671414 NCBI
  • RefSeq: WP_000748760 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MKKSKRLEIVSTIVKKHKIYKKEQIISYIEEYFGVRYSATTIAKDLKELNIYRVPIDCETWIYKAINNQTEQEMREKFRHYCEHEVLSSIINGSYIIVKTSPGFAQGINYFIDQLNIEEILGTVSGNDTTLILTASNDMAEYVYAKLFK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • NWMN_RS14570 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]