From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA0007 [new locus tag: SA_RS00175 ]
  • pan locus tag?: SAUPAN000013000
  • symbol: SA0007
  • pan gene symbol?: nnrD
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA0007 [new locus tag: SA_RS00175 ]
  • symbol: SA0007
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 9762..10592
  • length: 831
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    ATGGGAGGTTATATCACTATGGAAACGTTAAATTCTATTAACATTCCTAAGCGTAAAGAA
    GATTCACATAAAGGTGATTATGGCAAAATTTTATTAATTGGTGGATCTGCTAACTTAGGT
    GGTGCCATTATGTTAGCGGCTCGTGCATGTGTATTTAGCGGTAGTGGTTTAATCACTGTA
    GCTACACATCCAACAAATCATTCAGCATTACATTCTCGTTGCCCAGAAGCGATGGTTATT
    GATATTAATGATACGAAAATGTTGACGAAAATGATTGAAATGACTGACAGTATACTAATT
    GGTCCAGGTCTTGGCGTTGATTTCAAAGGAAATAATGCCATTACATTCCTACTACAAAAT
    ATACAACCGCATCAAAATTTAATCGTAGACGGCGATGCGATTACAATCTTTAGTAAACTG
    AAACCGCAATTACCTACATGTCGTGTGATCTTTACTCCACACCTCAAAGAATGGGAACGA
    TTAAGTGGTATTCCTATTGAGGAACAGACATATGAGCGTAATCGTGAAGCAGTTGATCGT
    TTAGGTGCAACTGTTGTACTTAAAAAACATGGTACTGAAATTTTCTTTAAAGATGAAGAC
    TTTAAATTAACAATCGGTAGCCCAGCAATGGCGACTGGTGGTATGGGCGATACACTTGCT
    GGTATGATTACAAGTTTTGTCGGTCAATTTGATAACTTAAAAGAAGCGGTTATGAGTGCC
    ACATATACACATAGTTTTATTGGCGAAAACCTTGCAAAAGATATGTATGTGGTACCACCA
    TCAAGACTTATCAATGAAATACCTTACGCAATGAAACAATTAGAAAGTTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    831

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA0007 [new locus tag: SA_RS00175 ]
  • symbol: SA0007
  • description: hypothetical protein
  • length: 276
  • theoretical pI: 6.51215
  • theoretical MW: 30171.7
  • GRAVY: -0.0384058

Function[edit source | edit]

  • reaction:
    EC 4.2.1.136?  ExPASy
    ADP-dependent NAD(P)H-hydrate dehydrataseADP + (6S)-6-beta-hydroxy-1,4,5,6-tetrahydronicotinamide adenine-dinucleotide = AMP + phosphate + NADHADP + (6S)-6-beta-hydroxy-1,4,5,6-tetrahydronicotinamide adenine-dinucleotide phosphate = AMP + phosphate + NADPH
  • TIGRFAM:
    Unknown functionGeneralYjeF family C-terminal domain (TIGR00196; HMM-score: 185.4)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersThiaminehydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase (TIGR00097; EC 2.7.1.49,2.7.4.7; HMM-score: 28.1)
    MetabolismEnergy metabolismSugarsribokinase (TIGR02152; EC 2.7.1.15; HMM-score: 13.4)
  • TheSEED:  
    ADP-dependent (S)-NAD(P)H-hydrate dehydratase (EC 4.2.1.136) 
  • PFAM:
    Ribokinase (CL0118) Carb_kinase; Carbohydrate kinase (PF01256; HMM-score: 194.4)
    Phos_pyr_kin; Phosphomethylpyrimidine kinase (PF08543; HMM-score: 30.4)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors: Mg2+
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 0.67
    • Signal Peptide Possibility: -0.5
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.188
    • Ymax_pos: 61
    • Cmax: 0.137
    • Cmax_pos: 70
    • Smax: 0.428
    • Smax_pos: 53
    • Smean: 0.178
    • D: 0.184
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MGGYITMETLNSINIPKRKEDSHKGDYGKILLIGGSANLGGAIMLAARACVFSGSGLITVATHPTNHSALHSRCPEAMVIDINDTKMLTKMIEMTDSILIGPGLGVDFKGNNAITFLLQNIQPHQNLIVDGDAITIFSKLKPQLPTCRVIFTPHLKEWERLSGIPIEEQTYERNREAVDRLGATVVLKKHGTEIFFKDEDFKLTIGSPAMATGGMGDTLAGMITSFVGQFDNLKEAVMSATYTHSFIGENLAKDMYVVPPSRLINEIPYAMKQLES

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SA0007 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]