From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA0130 [new locus tag: SA_RS00815 ]
  • pan locus tag?: SAUPAN000946000
  • symbol: SA0130
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA0130 [new locus tag: SA_RS00815 ]
  • symbol: SA0130
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 149935..150675
  • length: 741
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    GTGACGCAAACACAACCAAAATTTTTAACGATTTATAATACGTTATATAAAGAAATTCAA
    ATAGGAAAATATCCGAGTGGCCATGCATTACCTACTGAAAAGGAACTTTGTGCGCGCTTT
    GATGTCAGTCGTATGACTTTGCGCCAAGCTATAAAATTGTTAGCCGAAGATGGCATCGTA
    GAGAGTACAAGAGGGAAGGGACACTTTGTTATTCCACAAACAAATGCCCAACACGCTTCA
    AGTATGGATCAATTTAAGCATCCACTTGATCAAATATTGCTAGCTCGCGTATCTATGTCA
    TCAATTAATTATCGTGTTGATTTAGAAAGTGAATATACAAATCATTTGTTTGCAAACCAT
    CCTTCTGCCGTCATTGCAATGGAACGCTATTATCAAAAAAAGGACAATCATTCTAAGCAA
    GCTGATGCATTTTGCTTTACCTTTATACCGTTAAATGTCATTGACACATTTAAAGTGAAT
    ACACAAAACGAAGACGACATGAAGACATTCGTTGAGCAAACGATTTATAGCAATGCATAT
    CAATCAGATTTAAAAATGTCTATTACCAAAGCGCCCCGCTTCAAAAATCATAGTCACGTG
    TTTGATGGTGATACACATTGTTGGCTGATTATTGAAACACTGTACGCACAAACACCTTAT
    CCAATTATGATTAATAAGTGGTATATTCCACAGGAAATATCTGAATTAACACTGACACGT
    ATAAGACAATCGGATTATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    741

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA0130 [new locus tag: SA_RS00815 ]
  • symbol: SA0130
  • description: hypothetical protein
  • length: 246
  • theoretical pI: 7.34037
  • theoretical MW: 28600.4
  • GRAVY: -0.465447

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Signal transductionRegulatory functionsDNA interactionstrehalose operon repressor (TIGR02404; HMM-score: 68.2)
    MetabolismTransport and binding proteinsAnionsphosphonate metabolism transcriptional regulator PhnF (TIGR02325; HMM-score: 55.9)
    Signal transductionRegulatory functionsDNA interactionsphosphonate metabolism transcriptional regulator PhnF (TIGR02325; HMM-score: 55.9)
    MetabolismEnergy metabolismAmino acids and amineshistidine utilization repressor (TIGR02018; HMM-score: 55.1)
    Signal transductionRegulatory functionsDNA interactionshistidine utilization repressor (TIGR02018; HMM-score: 55.1)
    Signal transductionRegulatory functionsDNA interactionsphosphonate utilization transcriptional regulator PhnR (TIGR03337; HMM-score: 42.1)
    MetabolismFatty acid and phospholipid metabolismBiosynthesisfatty acid metabolism transcriptional regulator FadR (TIGR02812; HMM-score: 35.8)
    MetabolismFatty acid and phospholipid metabolismDegradationfatty acid metabolism transcriptional regulator FadR (TIGR02812; HMM-score: 35.8)
    Signal transductionRegulatory functionsDNA interactionsfatty acid metabolism transcriptional regulator FadR (TIGR02812; HMM-score: 35.8)
    phosphonate utilization associated transcriptional regulator (TIGR03338; HMM-score: 24.4)
    Unknown functionGeneralRrf2 family protein (TIGR00738; HMM-score: 15)
    Signal transductionRegulatory functionsDNA interactionsbiotin operon repressor (TIGR00122; HMM-score: 12.7)
  • TheSEED:  
    Predicted regulator for deoxynucleoside utilization, GntR family 
  • PFAM:
    HTH (CL0123) GntR; Bacterial regulatory proteins, gntR family (PF00392; HMM-score: 62.8)
    HTH_11; HTH domain (PF08279; HMM-score: 29.2)
    Rrf2; Transcriptional regulator (PF02082; HMM-score: 21.7)
    HTH_20; Helix-turn-helix domain (PF12840; HMM-score: 20.8)
    HTH_DeoR; DeoR-like helix-turn-helix domain (PF08220; HMM-score: 20.1)
    HTH_41; Helix-turn-helix domain (PF14502; HMM-score: 17)
    MarR_2; MarR family (PF12802; HMM-score: 16.6)
    HTH_36; Helix-turn-helix domain (PF13730; HMM-score: 13.9)
    HTH_24; Winged helix-turn-helix DNA-binding (PF13412; HMM-score: 13.8)
    HTH_23; Homeodomain-like domain (PF13384; HMM-score: 13.7)
    no clan definedPASTA; PASTA domain (PF03793; HMM-score: 13.4)
    HTH (CL0123) HTH_Crp_2; Crp-like helix-turn-helix domain (PF13545; HMM-score: 13.2)
    HTH_29; Winged helix-turn helix (PF13551; HMM-score: 12.3)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.113
    • Ymax_pos: 12
    • Cmax: 0.115
    • Cmax_pos: 56
    • Smax: 0.161
    • Smax_pos: 22
    • Smean: 0.125
    • D: 0.117
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MTQTQPKFLTIYNTLYKEIQIGKYPSGHALPTEKELCARFDVSRMTLRQAIKLLAEDGIVESTRGKGHFVIPQTNAQHASSMDQFKHPLDQILLARVSMSSINYRVDLESEYTNHLFANHPSAVIAMERYYQKKDNHSKQADAFCFTFIPLNVIDTFKVNTQNEDDMKTFVEQTIYSNAYQSDLKMSITKAPRFKNHSHVFDGDTHCWLIIETLYAQTPYPIMINKWYIPQEISELTLTRIRQSDY

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SA0130 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]