From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA0270 [new locus tag: SA_RS01585 ]
  • pan locus tag?: SAUPAN001174000
  • symbol: SA0270
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA0270 [new locus tag: SA_RS01585 ]
  • symbol: SA0270
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 325932..326825
  • length: 894
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    ATGAAGAAAACAATTTTACTGACGATGACAACTCTTACTTTATTTAGTATGTCGCCTAAC
    TCGGCTCAAGCATATACGAATGATAGCAAAACATTAGAAGAAGCAAAGAGAGCACACCCA
    AACGCACAGTTCAAAGTGAATAAAGACACCGGCGCGTATACTTATACATATGACAAAAAC
    AACACGCCAAACAACAATCATCAAAACCAGTCACGTACAAACGACAATCATCAACACGCA
    AATCAACGTGATTTTAACAACAATCAGTACCATTCTTCATTAAGTGGTCAGTATACGCAC
    ATTAATGACGCAATTGATTCACACACACCGCCTCAAACGTCACCAAGCAATCCTTTGACA
    CCAGCAATACCGAATGTCGAAGACAATGACGATGAATTAAATAACGCTTTTTCAAAAGAT
    AACAAAGGGCTTATTACAGGCATCGATTTAGACGAATTGTATGACGAATTACAAATCGCC
    GAATTTAATGACAAAGCAAAGACTGCTGACGGTAAACCTTTAGCATTAGGTAACGGTAAA
    ATCATTGATCAGCCTCTTATCACAAGTAAGAACAACTTATATACTGCTGGACAATGTACA
    TGGTATGTCTTTGATAAACGTGCCAAAGATGGACACACGATTAGTACATTTTGGGGAGAT
    GCTAAAAACTGGGCAGGCCAAGCTTCAAGCAATGGCTTCAAAGTAGATAGACACCCAACA
    CGAGGATCAATTTTACAAACAGTAAATGGTCCATTTGGTCATGTAGCCTACGTTGAAAAA
    GTTAATATTGATGGAAGTATTCTAATTTCAGAAATGAACTGGATTGGTGAATATATCGTT
    TCATCAAGAACCATCTCTGCTTCAGAAGTTTCATCATATAATTACATCCATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    894

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA0270 [new locus tag: SA_RS01585 ]
  • symbol: SA0270
  • description: hypothetical protein
  • length: 297
  • theoretical pI: 6.28254
  • theoretical MW: 33094
  • GRAVY: -0.801683

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
  • TheSEED:  
    Secretory antigen precursor SsaA 
  • PFAM:
    Peptidase_CA (CL0125) CHAP; CHAP domain (PF05257; HMM-score: 47.6)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Extracellular
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 0.09
    • Cellwall Score: 0.18
    • Extracellular Score: 9.73
    • Internal Helices: 0
  • LocateP: Secretory(released) (with CS)
    • Prediction by SwissProt Classification: Extracellular
    • Pathway Prediction: Sec-(SPI)
    • Intracellular Possibility: -0.17
    • Signal Peptide Possibility: 1
    • N-terminally Anchored Score: -2
    • Predicted Cleavage Site: NSAQAYTN
  • SignalP: Signal peptide length 25 aa
    • Ymax: 0.863
    • Ymax_pos: 25
    • Cmax: 0.826
    • Cmax_pos: 25
    • Smax: 0.971
    • Smax_pos: 6
    • Smean: 0.922
    • D: 0.886
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MKKTILLTMTTLTLFSMSPNSAQAYTNDSKTLEEAKRAHPNAQFKVNKDTGAYTYTYDKNNTPNNNHQNQSRTNDNHQHANQRDFNNNQYHSSLSGQYTHINDAIDSHTPPQTSPSNPLTPAIPNVEDNDDELNNAFSKDNKGLITGIDLDELYDELQIAEFNDKAKTADGKPLALGNGKIIDQPLITSKNNLYTAGQCTWYVFDKRAKDGHTISTFWGDAKNWAGQASSNGFKVDRHPTRGSILQTVNGPFGHVAYVEKVNIDGSILISEMNWIGEYIVSSRTISASEVSSYNYIH

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]