From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA0509 [new locus tag: SA_RS02975 ]
  • pan locus tag?: SAUPAN002323000
  • symbol: SA0509
  • pan gene symbol?: hchA
  • synonym:
  • product: chaperone protein HchA

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA0509 [new locus tag: SA_RS02975 ]
  • symbol: SA0509
  • product: chaperone protein HchA
  • replicon: chromosome
  • strand: +
  • coordinates: 595059..595937
  • length: 879
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    ATGTCACAAGATGTAAATGAATTAAGTAAGCAACCAACGCCAGATAAAGCAGAAGATAAC
    GCATTTTTCCCATCACCATATTCCCTTAGTCAATATACAGCACCTAAAACAGATTTTGAT
    GGTGTTGAACACAAAGGTGCCTATAAAGATGGTAAATGGAAAGTATTGATGATTGCTGCT
    GAAGAGAGATATGTATTATTGGAAAATGGAAAAATGTTCTCTACGGGTAATCATCCTGTT
    GAAATGTTATTACCTTTACATCATTTAATGGAAGCAGGTTTTGACGTTGATGTTGCGACA
    TTATCTGGTTATCCAGTTAAATTAGAATTATGGGCTATGCCAACTGAAGACGAGGCAGTT
    ATAAGTACTTATAATAAATTGAAAGAAAAATTAAAACAGCCAAAAAAATTAGCAGATGTG
    ATTAAAAATGAATTAGGACCTGATTCAGACTATTTATCTGTCTTTATCCCAGGCGGACAT
    GCTGCAGTTGTTGGTATTTCTGAAAGTGAGGACGTTCAACAAACATTAGATTGGGCATTA
    GACAATGACCGCTTTATAGTTACATTATGTCATGGACCAGCAGCACTACTTTCAGCAGGG
    CTTAACAGAGAAAAATCTCCATTAGAAGGATACTCTGTTTGTGTCTTCCCTGACTCATTA
    GATGAAGGTGCAAATATTGAAATAGGTTATTTACCTGGACGCTTGAAATGGTTAGTTGCT
    GATTTATTAACTAAACAAGGATTAAAAGTAGTTAACGACGATATGACAGGAAGAACGTTA
    AAAGATCGTAAATTATTAACAGGTGACAGTCCTTTAGCTTCAAATGAGTTAGGAAAATTA
    GCAGTTAATGAAATGTTAAATGCAATACAAAATAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    879

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA0509 [new locus tag: SA_RS02975 ]
  • symbol: SA0509
  • description: chaperone protein HchA
  • length: 292
  • theoretical pI: 4.65565
  • theoretical MW: 32176.4
  • GRAVY: -0.307877

Function[edit source | edit]

  • reaction:
    EC 3.5.1.-?  ExPASy
    EC 3.1.2.-?  ExPASy
  • TIGRFAM:
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesintracellular protease, PfpI family (TIGR01382; HMM-score: 28.8)
    Unknown functionGeneralDJ-1 family protein (TIGR01383; HMM-score: 17.5)
  • TheSEED:  
    D-lactate dehydratase (EC 4.2.1.130) 
  • PFAM:
    Glutaminase_I (CL0014) DJ-1_PfpI; DJ-1/PfpI family (PF01965; HMM-score: 38.6)
    ThiJ_like; ThiJ/PfpI family-like (PF17124; HMM-score: 20.6)
    RND_permease (CL0322) ACR_tran; AcrB/AcrD/AcrF family (PF00873; HMM-score: 9.9)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.67
    • Cytoplasmic Membrane Score: 0.01
    • Cellwall Score: 0.15
    • Extracellular Score: 0.17
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.157
    • Ymax_pos: 18
    • Cmax: 0.245
    • Cmax_pos: 18
    • Smax: 0.176
    • Smax_pos: 41
    • Smean: 0.105
    • D: 0.137
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MSQDVNELSKQPTPDKAEDNAFFPSPYSLSQYTAPKTDFDGVEHKGAYKDGKWKVLMIAAEERYVLLENGKMFSTGNHPVEMLLPLHHLMEAGFDVDVATLSGYPVKLELWAMPTEDEAVISTYNKLKEKLKQPKKLADVIKNELGPDSDYLSVFIPGGHAAVVGISESEDVQQTLDWALDNDRFIVTLCHGPAALLSAGLNREKSPLEGYSVCVFPDSLDEGANIEIGYLPGRLKWLVADLLTKQGLKVVNDDMTGRTLKDRKLLTGDSPLASNELGKLAVNEMLNAIQNK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]