From AureoWiki
Jump to: navigation, search

NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA0553 [new locus tag: SA_RS03200 ]
  • pan locus tag?: SAUPAN002442000
  • symbol: SA0553
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA0553 [new locus tag: SA_RS03200 ]
  • symbol: SA0553
  • product: hypothetical protein
  • replicon: chromosome
  • strand: +
  • coordinates: 646693..648087
  • length: 1395
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    ATGAGTATTGACATGTATTTAGACAGATCTCGAAACCAAGCTTCAAGTGTGGGGAATTTG
    AGTCAAACAATGAATTCAAATTATGATGCGTTGGAAAAAGCAATTACTCAATTTATCAAT
    GATGATGCGCTTAAAGGGAAAGCGTATACGTCAGCTAAGCAATTTTTTAGTACGGTGTTA
    ATTCCATTATCAACAAGTATGAAAACATTGAGTGATTTAACGAAGCAAGCTTGCGATAAT
    TTTGTGTCACGTTATACGAGTGAGGTTGATAGCATATCTTTAAAAGAATCAGAGCTTGAA
    GAAGATATCAGATCATTAAGTCAACAAATTACGCGATATGAAAATTTAACTAACAATTTG
    AAAAAGCATGCTTCCGATAATCAGCAAGCCATTTCATCGAACCAACAAATAATACAAACA
    TTAGGTCAACAAAAACATGAATTAGAAGAGAAACTACGTAAATTACGTGAGTTTAATCAA
    AAATCACCAGAAATATTTAAAGAAGTTGAAGAATTTCAAAAAATTGTCCAACAAGGACTT
    ACCCAAGCGCAGAATTTTTGGAACTTTTCAACAAATCAATTTAATATACCTTCAGGTAAA
    GAACTTGATTGGGCTAAAGCAAGTCATGAAAAATATTTGAAAGTTGCTATGGGGAAAATT
    GAACATAAAGCAGAGAAAGAAACTTTAAATAAAGCAGACTTTGCTGTTATAAAGGCATAT
    GCCAAAGAACATCCAGAAGACGATATCCCGAAAAGTATAATGAAATATATAAATGACAAT
    AAAGATAGTATTAAACGAGATATAGGATTAGATATTACGTCAACACTTTTAGAGCAAGGC
    GGTATAAATGCAAGTAAATTCGGTGTATTTATCAATACAGCAGGTGGAGTGAAAGGCCCA
    GCCGGTCCAAATTCATTTGTGGAAGTCAAACGTACATCAGGTAATGTGTTTATAGAAAAT
    GGTAGTAAATTTGCAAAAGGCGGAAAATATCTAGGGAAAGGTGTTGCAGGTGTAGGATTT
    GGTATAGGTATGTATGATGATCTTGCAAATGATAATAAAACATTTGGAGAGGCATTGTCG
    CATAATGGTATGACGCTTGCAGCTGGATCTGTTGCAGCATTTGGTGTAGCGGCTTTAGTA
    AGTAATCCAGTCGGTTGGGCTGTGGTAGGTATTTTAACAGCAGGTATTATTGGATCTACT
    GTTTCTGATTATCTTTATCAAAATAATTATTTTGGCATAAAAGATAAAGTGGACTGGGCA
    GGACATAAAATAGACGAGGGTATTGATGCTGTAAACAAAACTGCAGAAAAAGCTGTAGAT
    AGTGTTGGTAATGCCATTGGTGATGCCACAAAAAGTATTAGTAATCATATTAATCCTATG
    AAATGGAGTTGGTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1395

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA0553 [new locus tag: SA_RS03200 ]
  • symbol: SA0553
  • description: hypothetical protein
  • length: 464
  • theoretical pI: 6.73714
  • theoretical MW: 50976.9
  • GRAVY: -0.449353

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Cellular processesCellular processesCell divisionchromosome segregation protein SMC (TIGR02168; HMM-score: 14.5)
    Genetic information processingDNA metabolismChromosome-associated proteinschromosome segregation protein SMC (TIGR02168; HMM-score: 14.5)
    SH3 domain protein (TIGR04211; HMM-score: 14.4)
    Cellular processesCellular processesCell divisionchromosome segregation protein SMC (TIGR02169; HMM-score: 13.7)
    Genetic information processingDNA metabolismChromosome-associated proteinschromosome segregation protein SMC (TIGR02169; HMM-score: 13.7)
    two transmembrane protein (TIGR04527; HMM-score: 12.5)
    Signal transductionSignal transductionTwo-component systemsTMAO reductase sytem sensor TorS (TIGR02956; EC 2.7.13.3; HMM-score: 12.2)
    Cellular processesCellular processesPathogenesisvirulence factor Mce family protein (TIGR00996; HMM-score: 11.1)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype I secretion membrane fusion protein, HlyD family (TIGR01843; HMM-score: 4.1)
  • TheSEED:  
    hypothetical fig|282458.1.peg.573 homolog 
  • PFAM:
    no clan definedLXG; LXG domain of WXG superfamily (PF04740; HMM-score: 50.5)
    Laminin_II; Laminin Domain II (PF06009; HMM-score: 17.2)
    Tropomyosin-lke (CL0452) Tropomyosin_1; Tropomyosin like (PF12718; HMM-score: 17.2)
    no clan definedDegS; Sensor protein DegS (PF05384; HMM-score: 16.4)
    Ferritin (CL0044) DUF892; Domain of unknown function (DUF892) (PF05974; HMM-score: 16)
    no clan definedDUF3450; Protein of unknown function (DUF3450) (PF11932; HMM-score: 16)
    BCLiA (CL0551) APG6; Autophagy protein Apg6 (PF04111; HMM-score: 14.7)
    no clan definedDUF1664; Protein of unknown function (DUF1664) (PF07889; HMM-score: 13.5)
    DUF812; Protein of unknown function (DUF812) (PF05667; HMM-score: 13.4)
    TPR_MLP1_2; TPR/MLP1/MLP2-like protein (PF07926; HMM-score: 13.3)
    Fe_bilin_red; Ferredoxin-dependent bilin reductase (PF05996; HMM-score: 13.2)
    CALCOCO1; Calcium binding and coiled-coil domain (CALCOCO1) like (PF07888; HMM-score: 13.2)
    CorA; CorA-like Mg2+ transporter protein (PF01544; HMM-score: 13.1)
    GCN5L1; GCN5-like protein 1 (GCN5L1) (PF06320; HMM-score: 11.6)
    TMF_DNA_bd; TATA element modulatory factor 1 DNA binding (PF12329; HMM-score: 10.9)
    CemA; CemA family (PF03040; HMM-score: 10.3)
    Laminin_I; Laminin Domain I (PF06008; HMM-score: 10)
    Mce4_CUP1; Cholesterol uptake porter CUP1 of Mce4, putative (PF11887; HMM-score: 10)
    DUF4200; Domain of unknown function (DUF4200) (PF13863; HMM-score: 10)
    Exonuc_VII_L; Exonuclease VII, large subunit (PF02601; HMM-score: 9.8)
    GOLD-like (CL0521) GOLD_2; Golgi-dynamics membrane-trafficking (PF13897; HMM-score: 9.7)
    Reo_sigma (CL0326) Reo_sigmaC; Reovirus sigma C capsid protein (PF04582; HMM-score: 9.4)
    no clan definedProminin; Prominin (PF05478; HMM-score: 9.1)
    DUF948; Bacterial protein of unknown function (DUF948) (PF06103; HMM-score: 8.9)
    TMPIT; TMPIT-like protein (PF07851; HMM-score: 8.9)
    SlyX; SlyX (PF04102; HMM-score: 8.8)
    DUF2570; Protein of unknown function (DUF2570) (PF10828; HMM-score: 8.2)
    DUF2935; Domain of unknown function (DUF2935) (PF11155; HMM-score: 8.1)
    V_ATPase_I; V-type ATPase 116kDa subunit family (PF01496; HMM-score: 7.8)
    DUF2353; Uncharacterized coiled-coil protein (DUF2353) (PF09789; HMM-score: 7.8)
    DUF5082; Domain of unknown function (DUF5082) (PF16888; HMM-score: 7.2)
    Fzo_mitofusin; fzo-like conserved region (PF04799; HMM-score: 6.7)
    Prefoldin (CL0200) Prefoldin; Prefoldin subunit (PF02996; HMM-score: 6.5)
    no clan definedJnk-SapK_ap_N; JNK_SAPK-associated protein-1 (PF09744; HMM-score: 6.3)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 2
  • LocateP: Multi-transmembrane
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular Possibility: 0.17
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.158
    • Ymax_pos: 31
    • Cmax: 0.145
    • Cmax_pos: 31
    • Smax: 0.249
    • Smax_pos: 28
    • Smean: 0.183
    • D: 0.168
  • predicted transmembrane helices (TMHMM): 2

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MSIDMYLDRSRNQASSVGNLSQTMNSNYDALEKAITQFINDDALKGKAYTSAKQFFSTVLIPLSTSMKTLSDLTKQACDNFVSRYTSEVDSISLKESELEEDIRSLSQQITRYENLTNNLKKHASDNQQAISSNQQIIQTLGQQKHELEEKLRKLREFNQKSPEIFKEVEEFQKIVQQGLTQAQNFWNFSTNQFNIPSGKELDWAKASHEKYLKVAMGKIEHKAEKETLNKADFAVIKAYAKEHPEDDIPKSIMKYINDNKDSIKRDIGLDITSTLLEQGGINASKFGVFINTAGGVKGPAGPNSFVEVKRTSGNVFIENGSKFAKGGKYLGKGVAGVGFGIGMYDDLANDNKTFGEALSHNGMTLAAGSVAAFGVAALVSNPVGWAVVGILTAGIIGSTVSDYLYQNNYFGIKDKVDWAGHKIDEGIDAVNKTAEKAVDSVGNAIGDATKSISNHINPMKWSW

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]