From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA0835 [new locus tag: SA_RS04740 ]
  • pan locus tag?: SAUPAN003113000
  • symbol: clpB
  • pan gene symbol?: clpB
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA0835 [new locus tag: SA_RS04740 ]
  • symbol: clpB
  • product: hypothetical protein
  • replicon: chromosome
  • strand: +
  • coordinates: 946644..949253
  • length: 2610
  • essential: yes [1] DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    1861
    1921
    1981
    2041
    2101
    2161
    2221
    2281
    2341
    2401
    2461
    2521
    2581
    ATGGATATAAATAAAATGACATATGCTGTTCAAAGTGCTTTACAACAAGCAGTTGAACTG
    AGTCAGCAACATAAATTACAAAATATAGAAATTGAGGCAATTTTAAGCGCTGCCTTAAAT
    GAAAGTGAAAGCTTATATAAAAGTATTTTAGAACGAGCAAATATTGAGGTAGATCAATTA
    AACAAAGCTTATGAAGACAAACTAAACACGTATGCATCTGTAGAAGGTGACAATATACAA
    TATGGTCAATATATTAGCCAACAAGCAAACCAATTGATAACTAAGGCTGAATCATACATG
    AAAGAATATGAAGATGAATATATTTCAATGGAGCATATTTTACGTTCGGCAATGGACATT
    GATCAAACAACAAAACATTATATAAATAATAAAGTAGAAGTTATCAAAGAAATTATTAAA
    AAAGTAAGAGGGGGAAATCACGTGACATCACAAAATCCAGAAGTTAATTACGAAGCATTA
    GCTAAATATGGCCGCGACTTAGTAGAAGAAGTTAGACAAGGTAAAATGGATCCTGTTATA
    GGAAGAGATGAAGAAATTCGAAATACGATTCGTATTTTAAGTCGTAAAACTAAAAACAAC
    CCTGTGCTCATTGGTGAACCAGGTGTTGGTAAAACTGCAATTGTTGAAGGATTAGCGCAA
    CGTATAGTTAAGAAAGATGTGCCAGAATCATTATTAGATAAAACTGTTTTTGAGTTAGAT
    TTAAGCGCATTAGTAGCGGGCGCTAAATATCGTGGTGAATTTGAAGAGAGATTAAAAGCA
    GTCCTAAAAGAAGTTAAAGAGTCTGATGGTAGAATTATATTATTTATTGATGAAATCCAT
    ATGCTTGTAGGTGCTGGTAAAACAGATGGTGCCATGGATGCAGGCAACATGCTAAAACCA
    ATGTTAGCACGAGGAGAGTTACATTGTATTGGTGCAACAACTTTAAATGAATATCGAGAA
    TATATTGAAAAAGATTCGGCATTAGAGCGTCGTTTCCAAAAAGTAGCAGTTAGTGAGCCT
    GATGTTGAAGATACAATTTCAATTTTACGTGGTTTAAAAGAACGATATGAAGTGTATCAT
    GGTGTGCGTATTCAAGATAGAGCCTTAGTTGCTGCCGCTGAATTGTCTGATCGTTACATC
    ACTGATCGTTTTTTACCAGATAAAGCGATTGATTTAGTTGACCAAGCATGTGCAACAATT
    CGTACGGAAATGGGATCAAATCCAACTGAATTGGATCAAGTTAATAGACGTGTCATGCAA
    TTAGAAATTGAAGAAAGCGCACTTAAAAATGAATCTGACAATGCGAGCAAACAGAGATTA
    CAAGAACTACAAGAAGAGCTTGCCAATGAAAAAGAGAAACAAGCAGCACTTCAATCTCGT
    GTAGAATCAGAAAAAGAAAAAATAGCAAATTTACAAGAAAAACGTGCGCAACTAGATGAA
    AGTAGACAAGCGTTGGAAGATGCACAAACAAATAACAATTTAGAAAAAGCTGCTGAACTA
    CAATATGGAACAATTCCTCAATTGGAAAAAGAACTTAGAGAATTAGAGGATAATTTCCAA
    GATGAGCAAGGTGAAGATACAGATCGAATGATTCGTGAAGTTGTAACAGACGAAGAAATT
    GGCGATATTGTCAGCCAATGGACAGGCATACCAGTTTCAAAATTAGTTGAAACAGAACGT
    GAAAAATTACTTCACTTAAGTGACATCTTGCATAAACGTGTTGTAGGTCAAGATAAAGCG
    GTTGACCTGGTTTCAGATGCAGTAGTTAGAGCAAGAGCAGGTATTAAAGATCCAAACAGA
    CCTATTGGTAGTTTCTTATTCCTAGGTCCAACTGGAGTAGGTAAAACTGAATTAGCTAAA
    TCATTAGCTGCATCATTATTTGATTCTGAAAAACATATGATTCGTATTGATATGAGTGAA
    TATATGGAAAAACATGCAGTATCAAGATTGATAGGGGCACCTCCAGGATATATTGGACAT
    GATGAAGGGGGTCAATTAACTGAAGCGGTTCGTCGTAATCCATACTCAGTTATCTTATTA
    GATGAGGTTGAAAAAGCGCATACTGACGTCTTTAATGTATTATTGCAAATTTTAGATGAA
    GGCCGTTTAACTGATTCTAAAGGACGTAGCGTTGATTTTAAAAATACTATTATTATTATG
    ACAAGTAATATTGGATCTCAAGTTTTATTAGAAAACGTAAAAGAGACTGGTGAAATTACA
    GAATCAACAGAAAAAGCTGTTATGACAAATTTAAATGCATATTTCAAACCAGAAATTTTG
    AATCGTATGGATGACATCGTATTATTTAAACCTCTATCTATTGATGACATGAGTATGATT
    GTAGACAAAATATTAACGCAATTAAATATAAGATTATTAGAACAGCGAATCTCAATTGAA
    GTTTCTGATGATGCTAAAGCTTGGCTAGGTCAAGAAGCTTATGAACCTCAATACGGTGCA
    AGACCATTAAAACGTTTTGTACAACGCCAAATTGAAACACCATTAGCACGTATGATGATT
    AAAGAGGGATTCCCAGAAGGTACAACGATTAAAGTTAATTTAAATTCAGACAATAACTTA
    ACGTTTAATGTTGAAAAAATTCATGAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1860
    1920
    1980
    2040
    2100
    2160
    2220
    2280
    2340
    2400
    2460
    2520
    2580
    2610

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA0835 [new locus tag: SA_RS04740 ]
  • symbol: ClpB
  • description: hypothetical protein
  • length: 869
  • theoretical pI: 4.68338
  • theoretical MW: 98329.8
  • GRAVY: -0.4916

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Genetic information processingProtein fateProtein folding and stabilizationATP-dependent chaperone protein ClpB (TIGR03346; HMM-score: 1276.9)
    Cellular processesCellular processesPathogenesistype VI secretion ATPase, ClpV1 family (TIGR03345; HMM-score: 802.2)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype VI secretion ATPase, ClpV1 family (TIGR03345; HMM-score: 802.2)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesATP-dependent Clp protease ATP-binding subunit ClpA (TIGR02639; HMM-score: 778.9)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairHolliday junction DNA helicase RuvB (TIGR00635; EC 3.6.4.12; HMM-score: 23.9)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairDnaA regulatory inactivator Hda (TIGR03420; HMM-score: 21.4)
    Cellular processesCellular processesCell divisionchromosome segregation protein SMC (TIGR02169; HMM-score: 20.4)
    Genetic information processingDNA metabolismChromosome-associated proteinschromosome segregation protein SMC (TIGR02169; HMM-score: 20.4)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairDNA polymerase III, delta' subunit (TIGR00678; EC 2.7.7.7; HMM-score: 20.3)
    Cellular processesCellular processesOthergas vesicle protein GvpN (TIGR02640; HMM-score: 19.3)
    Cellular processesCellular processesSporulation and germinationATP-dependent protease LonB (TIGR02902; EC 3.4.21.-; HMM-score: 17.8)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesATP-dependent protease LonB (TIGR02902; EC 3.4.21.-; HMM-score: 17.8)
    Cellular processesCellular processesCell divisionchromosome segregation protein SMC (TIGR02168; HMM-score: 17.5)
    Genetic information processingDNA metabolismChromosome-associated proteinschromosome segregation protein SMC (TIGR02168; HMM-score: 17.5)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairDNA polymerase III, subunit gamma and tau (TIGR02397; EC 2.7.7.7; HMM-score: 16.5)
    Cellular processesCellular processesChemotaxis and motilityflagellar biosynthesis protein FlhF (TIGR03499; HMM-score: 16.1)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesPurine ribonucleotide biosynthesisadenylosuccinate synthase (TIGR00184; EC 6.3.4.4; HMM-score: 9.5)
  • TheSEED:  
    Protein MetabolismProtein degradationProteolysis in bacteria, ATP-dependent ClpB protein 
    Protein foldingProtein chaperones ClpB protein 
  • PFAM:
    P-loop_NTPase (CL0023) AAA_2; AAA domain (Cdc48 subfamily) (PF07724; HMM-score: 187.1)
    AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 94.5)
    no clan definedClpB_D2-small; C-terminal, D2-small domain, of ClpB protein (PF10431; HMM-score: 83.8)
    P-loop_NTPase (CL0023) AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 75.8)
    no clan definedClp_N; Clp amino terminal domain, pathogenicity island component (PF02861; HMM-score: 50.9)
    P-loop_NTPase (CL0023) AAA_16; AAA ATPase domain (PF13191; HMM-score: 46.1)
    Sigma54_activat; Sigma-54 interaction domain (PF00158; HMM-score: 43.2)
    AAA_22; AAA domain (PF13401; HMM-score: 33.5)
    AAA_14; AAA domain (PF13173; HMM-score: 30.5)
    IstB_IS21; IstB-like ATP binding protein (PF01695; HMM-score: 30)
    AAA_18; AAA domain (PF13238; HMM-score: 25.2)
    DUF815; Protein of unknown function (DUF815) (PF05673; HMM-score: 24.9)
    Mg_chelatase; Magnesium chelatase, subunit ChlI (PF01078; HMM-score: 24.8)
    ATPase_2; ATPase domain predominantly from Archaea (PF01637; HMM-score: 24.3)
    RuvB_N; Holliday junction DNA helicase ruvB N-terminus (PF05496; HMM-score: 23.9)
    Roc; Ras of Complex, Roc, domain of DAPkinase (PF08477; HMM-score: 23.5)
    RNA_helicase; RNA helicase (PF00910; HMM-score: 23.5)
    NACHT; NACHT domain (PF05729; HMM-score: 23.4)
    DNA_pol3_delta2; DNA polymerase III, delta subunit (PF13177; HMM-score: 21.5)
    AAA_24; AAA domain (PF13479; HMM-score: 20.9)
    RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 20.5)
    AAA_33; AAA domain (PF13671; HMM-score: 20.3)
    AAA_3; ATPase family associated with various cellular activities (AAA) (PF07726; HMM-score: 19.7)
    AAA_28; AAA domain (PF13521; HMM-score: 18.9)
    AAA_25; AAA domain (PF13481; HMM-score: 18.8)
    TsaE; Threonylcarbamoyl adenosine biosynthesis protein TsaE (PF02367; HMM-score: 18.7)
    Zeta_toxin; Zeta toxin (PF06414; HMM-score: 18.2)
    CbiA; CobQ/CobB/MinD/ParA nucleotide binding domain (PF01656; HMM-score: 17.4)
    NTPase_1; NTPase (PF03266; HMM-score: 16.9)
    SRP54; SRP54-type protein, GTPase domain (PF00448; HMM-score: 14.8)
    AAA_19; AAA domain (PF13245; HMM-score: 14.4)
    AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 12.8)
    Reo_sigma (CL0326) Reo_sigmaC; Reovirus sigma C capsid protein (PF04582; HMM-score: 12.5)
    P-loop_NTPase (CL0023) DUF87; Domain of unknown function DUF87 (PF01935; HMM-score: 11.2)
    ResIII; Type III restriction enzyme, res subunit (PF04851; HMM-score: 10.8)
    PhoH; PhoH-like protein (PF02562; HMM-score: 10.7)
    AAA_23; AAA domain (PF13476; HMM-score: 10.3)
    ABC_tran; ABC transporter (PF00005; HMM-score: 9.9)
    no clan definedExonuc_VII_L; Exonuclease VII, large subunit (PF02601; HMM-score: 7.3)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SA2302hypothetical protein  [2] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.138
    • Ymax_pos: 29
    • Cmax: 0.112
    • Cmax_pos: 29
    • Smax: 0.234
    • Smax_pos: 19
    • Smean: 0.133
    • D: 0.136
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MDINKMTYAVQSALQQAVELSQQHKLQNIEIEAILSAALNESESLYKSILERANIEVDQLNKAYEDKLNTYASVEGDNIQYGQYISQQANQLITKAESYMKEYEDEYISMEHILRSAMDIDQTTKHYINNKVEVIKEIIKKVRGGNHVTSQNPEVNYEALAKYGRDLVEEVRQGKMDPVIGRDEEIRNTIRILSRKTKNNPVLIGEPGVGKTAIVEGLAQRIVKKDVPESLLDKTVFELDLSALVAGAKYRGEFEERLKAVLKEVKESDGRIILFIDEIHMLVGAGKTDGAMDAGNMLKPMLARGELHCIGATTLNEYREYIEKDSALERRFQKVAVSEPDVEDTISILRGLKERYEVYHGVRIQDRALVAAAELSDRYITDRFLPDKAIDLVDQACATIRTEMGSNPTELDQVNRRVMQLEIEESALKNESDNASKQRLQELQEELANEKEKQAALQSRVESEKEKIANLQEKRAQLDESRQALEDAQTNNNLEKAAELQYGTIPQLEKELRELEDNFQDEQGEDTDRMIREVVTDEEIGDIVSQWTGIPVSKLVETEREKLLHLSDILHKRVVGQDKAVDLVSDAVVRARAGIKDPNRPIGSFLFLGPTGVGKTELAKSLAASLFDSEKHMIRIDMSEYMEKHAVSRLIGAPPGYIGHDEGGQLTEAVRRNPYSVILLDEVEKAHTDVFNVLLQILDEGRLTDSKGRSVDFKNTIIIMTSNIGSQVLLENVKETGEITESTEKAVMTNLNAYFKPEILNRMDDIVLFKPLSIDDMSMIVDKILTQLNIRLLEQRISIEVSDDAKAWLGQEAYEPQYGARPLKRFVQRQIETPLARMMIKEGFPEGTTIKVNLNSDNNLTFNVEKIHE

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator: CtsR
    CtsR (TF) important in Heat shock responseRegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. R Allyn Forsyth, Robert J Haselbeck, Kari L Ohlsen, Robert T Yamamoto, Howard Xu, John D Trawick, Daniel Wall, Liangsu Wang, Vickie Brown-Driver, Jamie M Froelich, Kedar G C, Paula King, Melissa McCarthy, Cheryl Malone, Brian Misiner, David Robbins, Zehui Tan, Zhan-yang Zhu Zy, Grant Carr, Deborah A Mosca, Carlos Zamudio, J Gordon Foulkes, Judith W Zyskind
    A genome-wide strategy for the identification of essential genes in Staphylococcus aureus.
    Mol. Microbiol.: 2002, 43(6);1387-400
    [PubMed:11952893] [WorldCat.org] (P p)
  2. Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]