From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA1018 [new locus tag: SA_RS05805 ]
  • pan locus tag?: SAUPAN003442000
  • symbol: SA1018
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA1018 [new locus tag: SA_RS05805 ]
  • symbol: SA1018
  • product: hypothetical protein
  • replicon: chromosome
  • strand: +
  • coordinates: 1153089..1153775
  • length: 687
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    TTGGGATATAAAAATATTTTGATAGACTTTGATGATACAATTGTTGATTTTTATGATGCA
    GAAGAATGGGCGTTTCACTATATGGCGAATGTTTTTAATCATAAAGCAACAAAGGATGAT
    TTTTTAACATTTAAAAAAATCAATCACCAACATTGGGAAGCTTTTCAACAAAATAAATTA
    ACGAAGTCTGAAGTATTATCAGAACGATTTGTGAATTACTTCAAACATCATCAAATGGAA
    GTTGATGGGCATCGTGCAGATGTGTTATTTAGAAATGGATTAGCAGAAGCTAAAGTTAAA
    TACTTTGATCAAACATTAGAAACAATTGTCGAATTATCGAAAAGACATGATTTATATATT
    GTTACTAATGGTGTAACCGAAACGCAAAAGAGAAGGTTAAATCAGACGCCGTTGCATAAA
    TATATTAAAAAGATATTTATATCTGAGGAAACAGGATATCAAAAACCTAATCCGGAATTT
    TTTAATTATGTTTTTAATGATATTGGTGAGGATGAAAGACAGCACTCGATTATAGTTGGA
    GATTCTTTAACATCTGACATTCTAGGTGGAATCAATGCGGGTATAGCTACTTGCTGGTTT
    AATTTTAGAGGATTTGATCATAATCCAGGAATTATACCTGATTATGAAATTAATTCATGG
    AAACAACTAAATGATATTGTACGTTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    687

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA1018 [new locus tag: SA_RS05805 ]
  • symbol: SA1018
  • description: hypothetical protein
  • length: 228
  • theoretical pI: 6.12286
  • theoretical MW: 26907
  • GRAVY: -0.572368

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    noncanonical pyrimidine nucleotidase, YjjG family (TIGR02254; EC 3.1.3.5; HMM-score: 200.2)
    HAD hydrolase, TIGR02253 family (TIGR02253; HMM-score: 94.8)
    Unknown functionEnzymes of unknown specificityHAD hydrolase, family IA, variant 1 (TIGR01549; HMM-score: 54.6)
    haloacid dehalogenase, type II (TIGR01428; EC 3.8.1.2; HMM-score: 41.1)
    HAD hydrolase, REG-2-like, family IA (TIGR02252; HMM-score: 41)
    Unknown functionEnzymes of unknown specificityHAD hydrolase, family IIA (TIGR01460; HMM-score: 37.8)
    Unknown functionEnzymes of unknown specificityHAD hydrolase, family IIIA (TIGR01662; HMM-score: 33.7)
    HAD hydrolase, TIGR01459 family (TIGR01459; HMM-score: 33.3)
    Unknown functionEnzymes of unknown specificityHAD hydrolase, family IA, variant 3 (TIGR01509; HMM-score: 30.4)
    HAD phosphatase, family IIIA (TIGR01668; EC 3.1.3.-; HMM-score: 26.4)
    MetabolismEnergy metabolismSugarsphosphoglycolate phosphatase, bacterial (TIGR01449; EC 3.1.3.18; HMM-score: 23)
    epoxide hydrolase N-terminal domain-like phosphatase (TIGR02247; HMM-score: 22.5)
    histidinol-phosphate phosphatase domain (TIGR01656; HMM-score: 21.2)
    beta-phosphoglucomutase family hydrolase (TIGR02009; HMM-score: 19.8)
    Unknown functionEnzymes of unknown specificityHAD hydrolase, TIGR01457 family (TIGR01457; HMM-score: 19.5)
    Unknown functionEnzymes of unknown specificityHAD hydrolase, TIGR01458 family (TIGR01458; HMM-score: 13.8)
    MetabolismEnergy metabolismBiosynthesis and degradation of polysaccharidesbeta-phosphoglucomutase (TIGR01990; EC 5.4.2.6; HMM-score: 13.8)
    HAD hydrolase, family IA, variant 2 (TIGR01493; HMM-score: 13)
  • TheSEED:  
    Housecleaning nucleoside triphosphate pyrophosphatases Pyrimidine 5'-nucleotidase YjjG (EC 3.1.3.5) 
  • PFAM:
    HAD (CL0137) HAD_2; haloacid dehalogenase-like hydrolase (PF13419; HMM-score: 78.9)
    Hydrolase_like; HAD-hyrolase-like (PF13242; HMM-score: 36.3)
    Hydrolase; haloacid dehalogenase-like hydrolase (PF00702; HMM-score: 36.2)
    HAD; haloacid dehalogenase-like hydrolase (PF12710; HMM-score: 14.7)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.095
    • Ymax_pos: 57
    • Cmax: 0.109
    • Cmax_pos: 39
    • Smax: 0.111
    • Smax_pos: 50
    • Smean: 0.055
    • D: 0.08
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MGYKNILIDFDDTIVDFYDAEEWAFHYMANVFNHKATKDDFLTFKKINHQHWEAFQQNKLTKSEVLSERFVNYFKHHQMEVDGHRADVLFRNGLAEAKVKYFDQTLETIVELSKRHDLYIVTNGVTETQKRRLNQTPLHKYIKKIFISEETGYQKPNPEFFNYVFNDIGEDERQHSIIVGDSLTSDILGGINAGIATCWFNFRGFDHNPGIIPDYEINSWKQLNDIVR

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SA1018 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]