From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA1132 [new locus tag: SA_RS06400 ]
  • pan locus tag?: SAUPAN003593000
  • symbol: SA1132
  • pan gene symbol?:
  • synonym:
  • product: 2-oxoglutarate ferredoxin oxidoreductase subunit beta

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA1132 [new locus tag: SA_RS06400 ]
  • symbol: SA1132
  • product: 2-oxoglutarate ferredoxin oxidoreductase subunit beta
  • replicon: chromosome
  • strand: +
  • coordinates: 1286910..1287776
  • length: 867
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    ATGGCGACATTTAAAGATTTTAGAAATAATGTTAAGCCTAACTGGTGCCCCGGATGTGGC
    GATTTCTCAGTACAAGCTGCAATTCAAAAAGCAGCCGCAAATATAGGGTTAGAACCTGAA
    GAAGTAGCTATCATCACCGGTATAGGATGTTCTGGCCGTCTTTCAGGATATATTAATTCT
    TATGGCGTTCATTCTATTCACGGACGTGCATTACCTTTAGCTCAAGGTGTAAAAATGGCG
    AATAAAGATTTAACTGTTATTGCATCGGGAGGAGATGGTGATGGTTATGCTATAGGTATG
    GGGCATACAATCCATGCTTTAAGAAGAAATATGAACATGACGTATATAGTCATGGATAAT
    CAAATTTATGGTTTGACAAAGGGACAAACATCGCCGTCATCAGCAGTAGGATTTGTTACT
    AAAACAACGCCAAAAGGTAATATAGAAAAAAATGTTGCGCCTTTAGAATTAGCATTATCA
    TCTGGTGCCACATTTGTAGCCCAAGGTTTTTCAAGCGATATTAAAGGATTAACAAAACTA
    ATTGAAGATGCAATTAATCATGATGGATTTTCATTCGTTAATGTCTTTTCACCATGTGTG
    ACTTATAATAAAATTAACACATACGATTGGTTTAAAGAACATTTAACAAGTGTTGATGAC
    ATTGAAAATTATGATTCTACAGATAAACAATTAGCGACTAAAACTGTTATTGAACATGAA
    TCTTTAGTAACTGGTATTGTTTATCAAGATAAAGAAACACCATCATATGAATCTCAAATT
    AAAGAGTTAGATGATACACCACTTGCTAAAAGAGATATCAAAATTACTGAAGACACCTTC
    AATGCATTAACTGAACAATTTATTTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    867

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA1132 [new locus tag: SA_RS06400 ]
  • symbol: SA1132
  • description: 2-oxoglutarate ferredoxin oxidoreductase subunit beta
  • length: 288
  • theoretical pI: 5.14363
  • theoretical MW: 31331.1
  • GRAVY: -0.222222

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    2-oxoacid:acceptor oxidoreductase, beta subunit, pyruvate/2-ketoisovalerate family (TIGR02177; HMM-score: 325.8)
    indolepyruvate ferredoxin oxidoreductase, alpha subunit (TIGR03336; EC 1.2.7.8; HMM-score: 51.9)
    pyruvate:ferredoxin (flavodoxin) oxidoreductase (TIGR02176; EC 1.2.7.1; HMM-score: 43)
    sulfopyruvate decarboxylase, beta subunit (TIGR03846; EC 4.1.1.79; HMM-score: 25.4)
    MetabolismEnergy metabolismSugars3,5/4-trihydroxycyclohexa-1,2-dione hydrolase (TIGR04377; EC 3.7.1.-; HMM-score: 23.4)
    MetabolismAmino acid biosynthesisPyruvate familyacetolactate synthase, large subunit, biosynthetic type (TIGR00118; EC 2.2.1.6; HMM-score: 18)
    phosphonopyruvate decarboxylase (TIGR03297; EC 4.1.1.82; HMM-score: 17)
    MetabolismCentral intermediary metabolismOthersulfoacetaldehyde acetyltransferase (TIGR03457; EC 2.3.3.15; HMM-score: 15.2)
  • TheSEED:  
    TCA Cycle 2-oxoglutarate/2-oxoacid ferredoxin oxidoreductase, beta subunit (EC 1.2.7.-) 
  • PFAM:
    THDP-binding (CL0254) TPP_enzyme_C; Thiamine pyrophosphate enzyme, C-terminal TPP binding domain (PF02775; HMM-score: 112.4)
    no clan definedPFO_beta_C; Pyruvate ferredoxin oxidoreductase beta subunit C terminal (PF12367; HMM-score: 77.8)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 0.83
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.166
    • Ymax_pos: 34
    • Cmax: 0.138
    • Cmax_pos: 34
    • Smax: 0.27
    • Smax_pos: 26
    • Smean: 0.171
    • D: 0.168
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MATFKDFRNNVKPNWCPGCGDFSVQAAIQKAAANIGLEPEEVAIITGIGCSGRLSGYINSYGVHSIHGRALPLAQGVKMANKDLTVIASGGDGDGYAIGMGHTIHALRRNMNMTYIVMDNQIYGLTKGQTSPSSAVGFVTKTTPKGNIEKNVAPLELALSSGATFVAQGFSSDIKGLTKLIEDAINHDGFSFVNVFSPCVTYNKINTYDWFKEHLTSVDDIENYDSTDKQLATKTVIEHESLVTGIVYQDKETPSYESQIKELDDTPLAKRDIKITEDTFNALTEQFI

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]