From AureoWiki
Jump to: navigation, search
Pangenome04-0298108BA0217611819-9771193COLECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50N315NCTC8325NewmanRF122ST398T0131TCH60TW20USA300_FPR3757USA300_TCH1516VC40

NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA1268
  • pan locus tag?: SAUPAN003877000
  • symbol: ebhB
  • pan gene symbol?: ebhB
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA1268
  • symbol: ebhB
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 1458130..1469802
  • length: 11673
  • essential: no DEG

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    1861
    1921
    1981
    2041
    2101
    2161
    2221
    2281
    2341
    2401
    2461
    2521
    2581
    2641
    2701
    2761
    2821
    2881
    2941
    3001
    3061
    3121
    3181
    3241
    3301
    3361
    3421
    3481
    3541
    3601
    3661
    3721
    3781
    3841
    3901
    3961
    4021
    4081
    4141
    4201
    4261
    4321
    4381
    4441
    4501
    4561
    4621
    4681
    4741
    4801
    4861
    4921
    4981
    5041
    5101
    5161
    5221
    5281
    5341
    5401
    5461
    5521
    5581
    5641
    5701
    5761
    5821
    5881
    5941
    6001
    6061
    6121
    6181
    6241
    6301
    6361
    6421
    6481
    6541
    6601
    6661
    6721
    6781
    6841
    6901
    6961
    7021
    7081
    7141
    7201
    7261
    7321
    7381
    7441
    7501
    7561
    7621
    7681
    7741
    7801
    7861
    7921
    7981
    8041
    8101
    8161
    8221
    8281
    8341
    8401
    8461
    8521
    8581
    8641
    8701
    8761
    8821
    8881
    8941
    9001
    9061
    9121
    9181
    9241
    9301
    9361
    9421
    9481
    9541
    9601
    9661
    9721
    9781
    9841
    9901
    9961
    10021
    10081
    10141
    10201
    10261
    10321
    10381
    10441
    10501
    10561
    10621
    10681
    10741
    10801
    10861
    10921
    10981
    11041
    11101
    11161
    11221
    11281
    11341
    11401
    11461
    11521
    11581
    11641
    GTGAATTATCGTGATAAAATTCAAAAGTTTAGTATTCGTAAATATACAGTTGGTACATTT
    TCAACTGTCATTGCGACATTGGTATTTTTAGGATTCAATACATCACAAGCACATGCTGCT
    GAAACAAATCAACCAGCAAGCGTGGTTAAACAGAAACAACAAAGTAATAATGAACAGACT
    GAGAATCGAGAATCTCAAGTACAAAATTCTCAAAATTCACAAAATAGTCAATCATTATCC
    GCTACTCATGAAAATGAGCAACCAAATAATAGTCAAGCTAATTTAGTAAATCAAAAAGTA
    GCGCAATCATCTACTACTAATGATGAACAACCAGCATCTCAAAATGTAAATACAAAGAAA
    GATTCGGCAACGGCTGCGACAACACAACCAGATAAAGAAGAAAGTAAGCATAAACAAAAC
    GAAAGTCAATCTGCTAATAAAAATGGAAACGACAATAGAGCGGCTCATGTAGAAAATCAT
    GAAGCAAATGTAGTAACAGCTTCAGATTCATCTGATAATGGTAACGTACAACATGACCGA
    AATGAATTACAAGCATTTTTTGATGCAAATTATCATGATTATCGCTTTATTGACCGTGAA
    AATGCAGATTCTGGCACATTTAACTATGTAAAAGGCATTTTTGACAAGATTAATACTTTA
    TTAGGCAGTAATGATCCAATTAACAATAAAGACTTGCAACTTGCATACAAAGAATTGGAA
    CAAGCTGTTGCTTTAATTCGTACAATGCCTCAACGTCAACAAACTAGCCGTCGATCAAAC
    AGAATTCAAACGCGTTCTGTTGAGTCTAGAGCTGCAGAGCCTAGATCAGTATCAGACTAT
    CAAAATGCAAATTCATCATATTATGTTGAAAATGCTAATGATGGTTCAGGATATCCTGTA
    GGTACATATATCAATGCTTCTAGTAAAGGGGCGCCATATAATTTACCAACTACACCATGG
    AATACATTGAAGGCCTCTGACTCAAAGGAAATTGCTCTTATGACAGCGAAACAAACTGGA
    GATGGCTACCAATGGGTTATTAAGTTTAATAAAGGACATGCTCCACATCAAAATATGATT
    TTCTGGTTTGCATTACCAGCAGACCAAGTGCCAGTAGGAAGAACTGACTTTGTAACAGTT
    AATTCAGATGGAACAAATGTACAATGGAGTCATGGAGCAGGAGCAGGTGCAAATAAACCA
    CTTCAACAAATGTGGGAATATGGAGTAAATGATCCTGATCGTTCACATGACTTTAAAATA
    AGAAATAGAAGTGGCCAAGTAATATATAGCTGGCCAACTGTCCATGTTTATTCTTTAGAA
    GATTTATCTAGAGCGAGTGATTATTTTAGTGAAGCTGGAGCGACACCTGCTACTAAAGCA
    TTTGGTAGACAAAATTTTGAATATATTAATGGTCAAAAACCTGCTGAATCACCGGGTGTT
    CCTAAAGTTTATACTTTCATCGGTCAAGGTGATGCAAGTTATACAATTTCATTTAAAACA
    CAAGGTCCAACTGTTAATAAATTGTATTATGCAGCAGGTGGGCGTGCTTTAGAGTACAAT
    CAATTATTTATGTACAGTCAACTATACGTCGAATCAACGCAAGACCATCAACAACGTCTT
    AATGGTTTAAGACAAGTGGTTAATCGTACATATCGCATAGGTACAACTAAACGTGTAGAA
    GTGAGTCAAGGAAATGTACAAACGAAAAAGGTATTAGAAAGTACAAACCTAAATATAGAT
    GATTTTGTTGATGATCCTTTAAGTTATGTTAAGACGCCGAGTAATAAAGTGTTAGGTTTT
    TACCCAACTAATGCAAATACTAACGCTTTTAGACCGGGGGGCGTTCAAGAATTAAATGAA
    TATCAATTAAGTCAATTATTTACTGATCAAAAATTACAAGAAGCAGCAAGAACTAGAAAC
    CCAATAAGATTAATGATTGGTTTCGACTATCCTGATGGTTATGGTAATAGTGAAACTTTA
    GTTCCTGTTAACTTAACGGTATTACCTGAAATCCAACATAATATTAAATTCTTTAAAAAT
    GACGATACTCAAAATATTGCTGAAAAACCATTTTCAAAACAAGCTGGGCATCCAGTTTTC
    TATGTATATGCAGGTAACCAAGGGAATGCTTCCGTGAATTTAGGTGGTAGCGTAACATCT
    ATTCAACCATTACGTATTAATTTAACAAGTAATGAGAATTTTACAGATAAAGATTGGCAA
    ATTACAGGTATTCCGCGTACATTACACATTGAAAACTCGACAAATAGAACTAATAATGCT
    AGAGAACGTAACATTGAACTTGTTGGTAATTTATTACCAGGGGATTACTTTGGTACGATA
    CGTTTTGGACGTAAAGAACAATTATTTGAAATTCGTGTTAAACCACATACACCAACAATT
    ACAACGACAGCTGAGCAATTAAGAGGTACAGCATTACAAAAAGTGCCTGTTAATATTTCG
    GGAATACCGTTGGATCCATCGGCATTGGTTTATTTAGTTGCACCAACAAATCAAACTACG
    AATGGTGGTAGTGAGGCAGATCAAATACCATCTGGTTATACGATACTTGCGACTGGTACA
    CCTGATGGGGTGCATAATACAATTACTATACGACCGCAAGATTATGTTGTATTCATACCA
    CCTGTAGGTAAACAAATTAGAGCAGTAGTTTATTATAATAAAGTAGTTGCATCTAATATG
    AGTAATGCTGTTACTATTTTGCCAGATGACATTCCACCAACAATCAATAATCCTGTTGGA
    ATAAATGCCAAATACTATCGAGGCGACGAAGTCAACTTTACAATGGGAGTCTCTGATAGA
    CATTCTGGTATAAAAAATACAACTATTACTACTTTGCCAAGTGGTTGGACATCAAATTTA
    ACTAAATCCGACAACAAAAACGGCTCATTAGCTATTACAGGTAGAGTCTCTATGAATCAG
    GCATTTAACAGTGATATTACATTTAAAGTATCAGCGACAGACAATGTCAATAATACGACA
    AATGATAGTCAATCTAAACATGTGTCAATTCATGTAGGTAAAATTAGTGAAGATGCTCAT
    CCGATTGTATTAGGAAATACTGAGAAAGTTGTAGTAGTCAATCCGACTGCTGTATCTAAT
    GATGAAAAGCAAAGCATAATTACTGCCTTTATGAATAAAAACCAAAATATAAGAGGATAT
    TTAGCATCAACTGATCCAGTAACTGTCGATAATAATGGTAACGTCACATTACATTACCGT
    GATGGCTCATCAACAACGCTTGATGCTACAAATGTGATGACATACGAACCAGTTGTGAAA
    TCTGAATATCAAACTGCCAATGCTGCTAAAACAGCAACGGTAACGATTGCTAAAGGACAA
    TCATTTAATATTGGTGATATTAAACAATATTTTACTTTAAGTAATGGACAAGCTATTCCA
    AATGGCACATTTACAAATATTACATCTGATAGAACTATTCCAACTGCACAAGAAGTTAGT
    CAAATGAATGCAGGTACGCAGTTATATCATATAGTTGCTTCAAATGCATATCATAAAGAC
    ACTGAAGATTTCTATATTAGTTTAAAAATCGTTGATGTGAAACAACCTGAAGGCGATCAA
    CGTGTCTATCGTACGTCAACATATGATTTAACCACTGATGAAATCTCAAAAGTAAAACAA
    GCTTTTATTAATGCAAATAGAGATGTAATTACGCTTGCCGAAGGTGATATTTCAGTTACA
    AATACACCTAATGGTGCTAATGTAAGTACTATTACAGTAAATATTAATAAAGGTCGATTA
    ACGAAATCATTCGCGTCTAACCTAGCTAATATGAATTTCTTGCGTTGGGTTAATTTCCCA
    CAAGATTATACAGTGACATGGACGAATGCAAAAATTGCAAACAGACCAACAGATGGTGGT
    TTATCATGGTCCGATGACCATAAATCTTTAATTTATCGTTATGATGCTACATTAGGCACA
    CAAATTACAACTAATGATATTTTAACGATGCTAAAAGCGACTACTACAGTGCCTGGATTG
    CGTAATAATATTACTGGTAATGAAAAAGCACAAGCAGAAGCAGGTGGAAGACCAAACTAT
    AGAACAACTGGTTATTCACAATCAAATGCGACAACTGATGGTCAACGTCAATTTACGTTG
    AATGGTCAAGTGATTCAAATATTAGACATCATCAACCCTTCAAACGGTTATGGTGGGCAA
    CCTGTTACAAATTCAAATACTCGTGCAAACCATAGTAACTCAACTGTTGTTAACGTAAAC
    GAACCGGCAGCTAATGGTGCTGGCGCATTTACAATTGACCACGTTGTAAAAAGTAATTCT
    ACACATAATGCAAGTGATGCAGTTTATAAAGCGCAGTTATACTTAACGCCATATGGTCCA
    AAACAATATGTTGAACATTTAAATCAAAATACAGGAAATACTACTGACGCTATTAACATT
    TATTTTGTACCAAGTGACTTAGTGAATCCAACAATTTCAGTAGGTAATTACACTAATCAT
    CAAGTGTTCTCAGGTGAAACATTTACAAATACGATTACAGCGAATGATAACTTTGGTGTG
    CAATCGGTAACTGTACCAAATACATCACAAATTACAGGTACTGTTGATAATAACCATCAA
    CATGTTTCTGCAACGGCACCAAATGTGACATCAGCAACTAGTAAGACAATCAATTTATTA
    GCAACTGATACAAGTGGTAATACAGCTACAACTTCATTCAATGTAACAGTGAAACCTTTG
    CGTGATAAATATCGAGTTGGTACTTCATCAACGGCTGCTAATCCTGTTAGAATTGCCAAT
    ATTTCGAATAATGCGACAGTATCACAAGCTGATCAAACGACAATTATTAATTCGTTAACG
    TTTACAAGTAATGCACCAAATAGAAACTATGCAACAGCAAGCGCAAATGAAATCACTAGT
    AAAACAGTTAGTAATGTCAGTCGTACTGGAAATAATGCCAATGTCACAGTAACTGTTACT
    CATCAAGATGGAACAACATCAACAGTGACTGTACCTGTAAAGCATGTCATTCCAGAAATC
    GTTGCACATTCGCATTACACTGTACAAGGCCAAGACTTCCCAGCAGGTAATGGTTCTAGT
    GCAGCAGATTACTTTAAGTTATCTAATGGTAGTGCCATTCCAGATGCAACGATTACATGG
    GTAAGTGGACAAGCGCCAAATAAAGATAATACACGTATTGGTGAAGATATAACAGTAACT
    GCACATATCTTAATTGATGGCGAAACAACGCCGATTACGAAAACAGCAACATATAAAGTA
    GTAAGAACTGTACCGAAACATGTCTTTGAAACAGCCAGAGGTGTTTTATACCCAGGTGTT
    TCAGATATGTATGATGCGAAACAATATGTTAAGCCAGTAAATAATTCTTGGTCGACAAAT
    GCGCAACATATGAATTTTCAATTTGTTGGAACATATGGTCCTAACAAAGATGTTGTAGGT
    ATATCAACGCGTCTTATTAGAGTGACTTATGATAATAGACAAACTGAAGATTTAACTATT
    TTATCTAAAGTTAAACCTGACCCACCAAGAATTGACGCAAACTCTGTGACATATAAAGCA
    GGTCTTACAAACCAAGAAATTAAAGTTAATAACGTATTAAATAACTCGTCAGTAAAATTA
    TTTAAAGCAGATAATACACCATTAAATGTCACAAATATTACTCATGGTAGTGGTTTTAGT
    TCGGTTGTGACAGTAAGTGACGCGTTACCAAATGGCGGAATTAAAGCAAAATCTTCAATT
    TCAATGAACAATGTGACGTATACGACGCAAGACGAACATGGTCAAGTTGTTACAGTAACA
    AGAAATGAATCTGTTGATTCAAATGATAGTGCTTCTGTTACAGTAACACCACAATTACAA
    GCAACTACTGAAGGCGCTGTATTTATTAAAGGTGGCGACGGTTTTGATTTCGGTCATGTA
    GAACGATTTATTCAAAATCCGCCACATGGGGCAACGGTCGCATGGCATGATAGTCCAGAT
    ACATGGAAGAATACAGTCGGCAACACACATAAAACTGCGGTTGTAACATTACCTAGTGGT
    CAAGGTACGCGTAATGTTGAAGTTCCAGTCAAAGTTTATCCAGTTGCTAATGCTAAGGCG
    CCATCACGTGATGTGAAAGGTCAAAATTTGACACATGGTACAAACGCTATTGATTACATT
    ACATTTGATCCAAATACTAATACGAATGGTATTACAGCAGCATGGGCAAATAGACAACAA
    CCAAATAACCAGCAAGCAGGCGTTCAACATTTAAATGTCGATGTCACATATCCAGGTATT
    TCAGCTGCTAAACGAGTTCCTGTAACTGTGAACGTATATCAATTTGAATTCCCTCAAACT
    ACTTATACAACAACAGTTGGTGGCACTTTAGCAAGTGGTACGCAAGCATCAGGATATGCA
    CATATGCAAAACGCTTCAGGTTTACCAACAGATGGATTTACGTATAAATGGAATCGTGAT
    ACTACGGGTACAAACGATGCAAACTGGGCAGCAATGAATAAACCAAATACTGCACAAGTC
    GTTAATGCAAAATATGATGTCATCTATAATGGACATACATTTGCAACATCTTTACCAGCG
    AAATTTGTAGTAAAAGATGTTCAACCAGCGAAACCAACTGTCACTGAAACAGCGGCAGGA
    GCGATTACAATTGCACCTGGTGCGAACCAAACAGTCAATACTCATGCTGGTAATGTTACG
    ACATATGCTGACAAATTAGTTATTAAACGTAATGGAAATGTTGTAACGACATTTACACGT
    CGTAATAATACGAGCCCATGGGTGAAAGAAGCATCAGCAGATAATGTAACAGGTATTGTT
    GGAACTAATAATGGTATTACTGTGGCAGCAGGTACTTTCAATCCTGCTGATACAATTCAA
    GTTGTTGCAACACAAGGTAGTGGCGAAACAATCAGTGACGAGCAACGTAGTGATGATTTC
    ACAGTTGTCGCACCACAACCGAACCAAGCGACTACGAAAATTTGGCAAAATGGTCATATT
    GATATCACGCCTAATAATCCATCAGGACATTTAATTAATCCAACACAAGCAATGGATATT
    GCTTACACTGAAAAAGTGGGTAATGGTGCAGAACATAGTAAGACAATTAATGTTGTTCGT
    GGTCAAAATAATCAATGGACAATTGCGAATAAGCCTGACTATGTAACGTTAGATGCACAA
    ACTGGTAAAGTGACGTTCAATGCCAATACTATAAAACCAAATTCATCAATCACAATTACT
    CCGAAAGCAGGTACAGGTCACTCAGTAAGTAGTAATCCAAGTACATTAACTGCACCGGCA
    GCTCATACTGTCAACACAACTGAAATTGTGAAAGATTATGGTTCAAATGTAACAGCAGCT
    GAAATTAACAATGCAGTTCAAGTTGCTAATAAACGTACTGCAACGATTAAAAATGGCACA
    GCAATGCCTACTAATTTAGCTGGTGGTAGCACAACGACGATTCCTGTGACAGTAACTTAC
    AATGATGGTAGTACTGAAGAAGTACAAGAGTCCATTTTCACAAAAGCGGATAAACGTGAG
    TTAATCACAGCTAAAAATCATTTAGATGATCCAGTAAGCACTGAAGGTAAAAAGCCAGGT
    ACAATTACGCAGTACAATAATGCAATGCATAATGCGCAACAACAAATCAATACCGCGAAA
    ACAGAAGCACAACAAGTGATTAATAATGAGCGTGCAACACCACAACAAGTTTCTGACGCA
    CTAACTAAAGTTCGTGCAGCACAAACTAAGATTGATCAAGCTAAAGCATTACTTCAAAAT
    AAAGAAGATAATAGCCAATTAGTAACGTCTAAAAATAACTTACAAAGTTCTGTGAACCAA
    GTACCATCAACTGCTGGTATGACGCAACAAAGTATTGATAACTATAATGCGAAGAAGCGT
    GAAGCAGAAACTGAAATAACTGCAGCTCAACGTGTTATTGACAATGGCGATGCAACTGCA
    CAACAAATTTCAGATGAAAAACATCGTGTCGATAACGCATTAACAGCATTAAACCAAGCG
    AAACATGATTTAACTGCAGATACACATGCCTTAGAGCAAGCAGTGCAACAATTGAATCGC
    ACAGGTACAACGACTGGTAAGAAGCCGGCAAGTATTACTGCTTACAATAATTCGATTCGT
    GCACTTCAAAGTGACTTAACAAGTGCTAAAAATAGCGCTAATGCTATCATTCAGAAGCCA
    ATAAGAACAGTGCAAGAGGTACAATCTGCGTTAACAAATGTAAATCGTGTCAATGAGCGA
    TTAACGCAAGCAATTAATCAATTAGTACCTTTAGCTGATAATAGTGCTTTAAGAACTGCT
    AAGACGAAACTTGATGAAGAAATCAATAAATCAGTAACTACTGATGGTATGACACAATCA
    TCAATCCAAGCATATGAAAATGCTAAACGTGCAGGTCAAACAGAAACAACAAATGCACAA
    AATGTTATTAACAATGGTGACGCGACAGACCAACAAATTGCCGCAGAAAAAACAAAAGTA
    GAAGAAAAATATAATAGCTTAAAACAAGCAATTGCTGGATTAACACCAGACTTGGCACCA
    TTACAAACTGCAAAAACTCAGTTGCAAAATGATATTGATCAGCCAACGAGTACGACTGGT
    ATGACAAGCGCATCTGTTGCTGCATTTAATGACAAACTTTCAGCAGCTAGAACTAAAATT
    CAAGAAATTGATCGCGTACTAGCATCTCATCCAGATGTAGCAACGATTCGTCAAAACGTG
    ACAGCAGCGAATGCTGCTAAAACAGCACTTGATCAAGCGCGCAATGGCTTAACAGTCGAT
    AAAGCACCTTTAGAAAATGCGAAAAATCAACTACAACATAGTATTGATACGCAAACAAGT
    ACAACTGGTATGACACAAGACTCTATAAATGCATACAATGCGAAGTTAACAGCTGCACGT
    AATAAGGTTCAACAAATCAATCAAGTATTAGCAGGTTCACCTACTGTAGATCAAATTAAT
    ACAAATACGTCTGCAGCAAATCAAGCGAAATCTGATTTAGATCATGCACGTCAAGCGTTA
    ACACCAGATAAAGCGCCGCTTCAAAATGCGAAAACGCAATTAGAACAAAGCATTAATCAA
    CCAACAGATACAACAGGTATGACAACCGCTTCGTTAAATGCATACAACCAAAAATTACAA
    GCAGCACGTCAAAAGTTAACTGAAATTAATCAAGTGTTGAATGGCAACCCAACTGTCCAA
    AATATCAATGATAAAGTGGCAGAGGCAAACCAAGCTAAGGATCAATTAAATACAGCACGT
    CAAGGTTTAACATTAGATAGACAGCCAGCGTTAACAACATTACATGGTGCATCTAACTTA
    AACCAAGCACAACAAAATAATTTCACGCAACAAATTAATGCTGCTCAAAATCATGCTGCG
    CTTGAAACAATTAAGTCTAACATTACGGCTTTAAATACTGCGATGACGAAATTAAAAGAC
    AGTGTTGCGGATAATAATACAATTAAATCAGGTCAAAATTACACTGACGCAACACCAGCT
    AATAAACAAGCCTATGATAATGCAGTTAATGCGGCTAAAGGTGTCATTGGAGAAACGACT
    AATCCAACGATGGATGTTAACACAGTGAACCAAAAAGCAGCATCTGTTAAATCGACGAAA
    GATGCTTTAGATGGTCAACAAAACTTACAACGTGCGAAAACAGAAGCAACAAATGCGATT
    ACGCATGCAAGTGATTTAAACCAAGCACAAAAGAATGCATTAACACAACAAGTGAATAGT
    GCACAAAACGTGCAAGCAGTAAATGATATTAAACAAACGACTCAAAGCTTAAATACTGCT
    ATGACAGGTTTAAAACGTGGCGTTGCTAATCATAACCAAGTCGTACAAAGTGATAATTAT
    GTCAACGCAGATACTAATAAGAAAAATGATTACAACAATGCATACAACCATGCGAATGAC
    ATTATTAATGGTAATGCACAACATCCAGTTATAACACCAAGTGATGTTAACAATGCTTTA
    TCAAATGTCACAAGTAAAGAACATGCATTGAATGGTGAAGCTAAGTTAAATGCTGCGAAA
    CAAGAAGCGAATACTGCATTAGGTCATTTAAACAATTTAAATAATGTACAACGTCAAAAC
    TTACAATCGCAAATTAATGGTGCGCATCAAATTGATGCAGTTAATACAATTAAGCAAAAT
    GCAACAAACTTGAATAGTGCAATGGGTAACTTAAGACAAGCTGTTGCAGATAAAGATCAA
    GTGAAACGTACAGAAGATTATGCGGATGCAGATACAGCTAAACAAAATGCATATAACAGT
    GCAGTTTCAAGTGCTGAAACAATTATTAATCAAACAGCTAATCCGACAATGTCTGTTGAT
    GATGTTAATCGTGCAACTTCAGCTGTTACTACTAATAAAAATGCATTAAATGGTGATGAA
    AAATTAGTACAATCTAAAACAGATGCTGCAAGAGCAATTGATGCATTACCACATTTAAAT
    AATGCACAAAAAGCAGATGTTAAATCTAAAATTAATGCTGCATCAAATATTGCTGGTGTA
    AATACCGTTAAACAACAAGGTACAGATTTAAATACAGCGATGGGTAACTTGCAGGGTGCA
    ATCAATGATGAACAAACGACGCTTAATAGTCAAAATTATCAAGATGCGACACCTAGTAAG
    AAAACAGCATACACAAATGCGGTGCAAGCTGCGAAAGATATTTTAAATAAATCAAATGGT
    CAAAATAAAACGAAAGATCAAGTTACTGAAGCGATGAATCAAGTGAATTCGGCTAAAAAT
    AACTTAGATGGTACGCGTTTATTAGATCAAGCGAAGCAAACAGCGAAACAGCAGTTAAAT
    AATATGACGCATTTAACAACTGCACAAAAAACGAATTTAACAAATCAAATTAATAGTGGT
    ACTACTGTTGCTGGTGTTCATACGGTTCAATCAAATGCCAACACATTAGATCAAGCGATG
    AATACGTTAAGACAAAGTATTGCTAACAATGATGCGACTAAAGCAAGTGAAGATTACGTA
    GATGCTAATAATGATAAGCAAACAGCATATAACAACGCGGTAGCTGCTGCTGAAACGATT
    ATTAATGCGAATAGTAATCCAGAAATGAATCCAAGTACGATTACACAAAAAGCAGAGCAA
    GTGAATAGTTCTAAAACGGCACTTAACGGTGATGAAAACTTAGCTACGGCAAAACAAAAT
    GCGAAAACGTACTTAAACACATTAACGAGTATTACAGATGCTCAAAAGAACAATTTGATT
    AGTCAAATTAGTAGTGCGACAAGAGTGAGTGGTGTTGATACTGTAAAACAAAATGCACAA
    CATTTAGATCAAGCTATGGCTAACTTACAAAATGGTATTAACAACGAATCTCAAGTGAAA
    TCATCTGAGAAATATCGTGATGCTGATACAAATAAACAACAAGAGTATGATAATGCTATT
    ACTGCAGCGAAAGCGATTTTAAATAAATCGACAGGTCCAAACACTGCGCAAAATGCAGTT
    GAAGCAGCATTGCAACGTGTTAATACTGCGAAAGATGCATTGAATGGTGATGCAAAATTA
    ATTGCAGCTCAAAACGCAGCGAAACAACATTTAGGTACTTTAACGCATATCACTACAGCA
    CAACGCAATGATTTAACAAATCAAATTTCATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1860
    1920
    1980
    2040
    2100
    2160
    2220
    2280
    2340
    2400
    2460
    2520
    2580
    2640
    2700
    2760
    2820
    2880
    2940
    3000
    3060
    3120
    3180
    3240
    3300
    3360
    3420
    3480
    3540
    3600
    3660
    3720
    3780
    3840
    3900
    3960
    4020
    4080
    4140
    4200
    4260
    4320
    4380
    4440
    4500
    4560
    4620
    4680
    4740
    4800
    4860
    4920
    4980
    5040
    5100
    5160
    5220
    5280
    5340
    5400
    5460
    5520
    5580
    5640
    5700
    5760
    5820
    5880
    5940
    6000
    6060
    6120
    6180
    6240
    6300
    6360
    6420
    6480
    6540
    6600
    6660
    6720
    6780
    6840
    6900
    6960
    7020
    7080
    7140
    7200
    7260
    7320
    7380
    7440
    7500
    7560
    7620
    7680
    7740
    7800
    7860
    7920
    7980
    8040
    8100
    8160
    8220
    8280
    8340
    8400
    8460
    8520
    8580
    8640
    8700
    8760
    8820
    8880
    8940
    9000
    9060
    9120
    9180
    9240
    9300
    9360
    9420
    9480
    9540
    9600
    9660
    9720
    9780
    9840
    9900
    9960
    10020
    10080
    10140
    10200
    10260
    10320
    10380
    10440
    10500
    10560
    10620
    10680
    10740
    10800
    10860
    10920
    10980
    11040
    11100
    11160
    11220
    11280
    11340
    11400
    11460
    11520
    11580
    11640
    11673

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA1268
  • symbol: EbhB
  • description: hypothetical protein
  • length: 3890
  • theoretical pI: 7.62348
  • theoretical MW: 420625
  • GRAVY: -0.632365

Function[edit source | edit]

  • TIGRFAM:
    hyperosmolarity resistance protein Ebh (TIGR04264; HMM-score: 3954)
    and 4 more
    gram-positive signal peptide, YSIRK family (TIGR01168; HMM-score: 36.7)
    Cellular processesCellular processesCell divisionchromosome segregation protein SMC (TIGR02168; HMM-score: 17.4)
    Genetic information processingDNA metabolismChromosome-associated proteinschromosome segregation protein SMC (TIGR02168; HMM-score: 17.4)
    MetabolismCentral intermediary metabolismNitrogen fixationV-containing nitrogenase, delta subunit (TIGR02930; EC 1.18.6.1; HMM-score: 10.1)
  • TheSEED:  
    Putative Staphylococcal surface anchored protein 
  • PFAM:
    B_GA (CL0598) FIVAR; FIVAR domain (PF07554; HMM-score: 395.4)
    and 5 more
    GA; GA module (PF01468; HMM-score: 284.7)
    no clan definedYSIRK_signal; YSIRK type signal peptide (PF04650; HMM-score: 36.1)
    E-set (CL0159) Rib; Rib/alpha-like repeat (PF08428; HMM-score: 27.1)
    B_GA (CL0598) GA-like; GA-like domain (PF17573; HMM-score: 11.1)
    E-set (CL0159) HYR; HYR domain (PF02494; HMM-score: 8.1)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cellwall
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 5.69
    • Extracellular Score: 4.31
    • Internal Helices: 0
  • LocateP: Secretory(released) (with CS)
    • Prediction by SwissProt Classification: Extracellular
    • Pathway Prediction: Sec-(SPI)
    • Intracellular Possibility: -0.17
    • Signal Peptide Possibility: 1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: SQAHAAET
  • SignalP: Signal peptide length 40 aa
    • Ymax: 0.817
    • Ymax_pos: 40
    • Cmax: 0.785
    • Cmax_pos: 40
    • Smax: 0.932
    • Smax_pos: 36
    • Smean: 0.695
    • D: 0.769
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MNYRDKIQKFSIRKYTVGTFSTVIATLVFLGFNTSQAHAAETNQPASVVKQKQQSNNEQTENRESQVQNSQNSQNSQSLSATHENEQPNNSQANLVNQKVAQSSTTNDEQPASQNVNTKKDSATAATTQPDKEESKHKQNESQSANKNGNDNRAAHVENHEANVVTASDSSDNGNVQHDRNELQAFFDANYHDYRFIDRENADSGTFNYVKGIFDKINTLLGSNDPINNKDLQLAYKELEQAVALIRTMPQRQQTSRRSNRIQTRSVESRAAEPRSVSDYQNANSSYYVENANDGSGYPVGTYINASSKGAPYNLPTTPWNTLKASDSKEIALMTAKQTGDGYQWVIKFNKGHAPHQNMIFWFALPADQVPVGRTDFVTVNSDGTNVQWSHGAGAGANKPLQQMWEYGVNDPDRSHDFKIRNRSGQVIYSWPTVHVYSLEDLSRASDYFSEAGATPATKAFGRQNFEYINGQKPAESPGVPKVYTFIGQGDASYTISFKTQGPTVNKLYYAAGGRALEYNQLFMYSQLYVESTQDHQQRLNGLRQVVNRTYRIGTTKRVEVSQGNVQTKKVLESTNLNIDDFVDDPLSYVKTPSNKVLGFYPTNANTNAFRPGGVQELNEYQLSQLFTDQKLQEAARTRNPIRLMIGFDYPDGYGNSETLVPVNLTVLPEIQHNIKFFKNDDTQNIAEKPFSKQAGHPVFYVYAGNQGNASVNLGGSVTSIQPLRINLTSNENFTDKDWQITGIPRTLHIENSTNRTNNARERNIELVGNLLPGDYFGTIRFGRKEQLFEIRVKPHTPTITTTAEQLRGTALQKVPVNISGIPLDPSALVYLVAPTNQTTNGGSEADQIPSGYTILATGTPDGVHNTITIRPQDYVVFIPPVGKQIRAVVYYNKVVASNMSNAVTILPDDIPPTINNPVGINAKYYRGDEVNFTMGVSDRHSGIKNTTITTLPSGWTSNLTKSDNKNGSLAITGRVSMNQAFNSDITFKVSATDNVNNTTNDSQSKHVSIHVGKISEDAHPIVLGNTEKVVVVNPTAVSNDEKQSIITAFMNKNQNIRGYLASTDPVTVDNNGNVTLHYRDGSSTTLDATNVMTYEPVVKSEYQTANAAKTATVTIAKGQSFNIGDIKQYFTLSNGQAIPNGTFTNITSDRTIPTAQEVSQMNAGTQLYHIVASNAYHKDTEDFYISLKIVDVKQPEGDQRVYRTSTYDLTTDEISKVKQAFINANRDVITLAEGDISVTNTPNGANVSTITVNINKGRLTKSFASNLANMNFLRWVNFPQDYTVTWTNAKIANRPTDGGLSWSDDHKSLIYRYDATLGTQITTNDILTMLKATTTVPGLRNNITGNEKAQAEAGGRPNYRTTGYSQSNATTDGQRQFTLNGQVIQILDIINPSNGYGGQPVTNSNTRANHSNSTVVNVNEPAANGAGAFTIDHVVKSNSTHNASDAVYKAQLYLTPYGPKQYVEHLNQNTGNTTDAINIYFVPSDLVNPTISVGNYTNHQVFSGETFTNTITANDNFGVQSVTVPNTSQITGTVDNNHQHVSATAPNVTSATSKTINLLATDTSGNTATTSFNVTVKPLRDKYRVGTSSTAANPVRIANISNNATVSQADQTTIINSLTFTSNAPNRNYATASANEITSKTVSNVSRTGNNANVTVTVTHQDGTTSTVTVPVKHVIPEIVAHSHYTVQGQDFPAGNGSSAADYFKLSNGSAIPDATITWVSGQAPNKDNTRIGEDITVTAHILIDGETTPITKTATYKVVRTVPKHVFETARGVLYPGVSDMYDAKQYVKPVNNSWSTNAQHMNFQFVGTYGPNKDVVGISTRLIRVTYDNRQTEDLTILSKVKPDPPRIDANSVTYKAGLTNQEIKVNNVLNNSSVKLFKADNTPLNVTNITHGSGFSSVVTVSDALPNGGIKAKSSISMNNVTYTTQDEHGQVVTVTRNESVDSNDSASVTVTPQLQATTEGAVFIKGGDGFDFGHVERFIQNPPHGATVAWHDSPDTWKNTVGNTHKTAVVTLPSGQGTRNVEVPVKVYPVANAKAPSRDVKGQNLTHGTNAIDYITFDPNTNTNGITAAWANRQQPNNQQAGVQHLNVDVTYPGISAAKRVPVTVNVYQFEFPQTTYTTTVGGTLASGTQASGYAHMQNASGLPTDGFTYKWNRDTTGTNDANWAAMNKPNTAQVVNAKYDVIYNGHTFATSLPAKFVVKDVQPAKPTVTETAAGAITIAPGANQTVNTHAGNVTTYADKLVIKRNGNVVTTFTRRNNTSPWVKEASADNVTGIVGTNNGITVAAGTFNPADTIQVVATQGSGETISDEQRSDDFTVVAPQPNQATTKIWQNGHIDITPNNPSGHLINPTQAMDIAYTEKVGNGAEHSKTINVVRGQNNQWTIANKPDYVTLDAQTGKVTFNANTIKPNSSITITPKAGTGHSVSSNPSTLTAPAAHTVNTTEIVKDYGSNVTAAEINNAVQVANKRTATIKNGTAMPTNLAGGSTTTIPVTVTYNDGSTEEVQESIFTKADKRELITAKNHLDDPVSTEGKKPGTITQYNNAMHNAQQQINTAKTEAQQVINNERATPQQVSDALTKVRAAQTKIDQAKALLQNKEDNSQLVTSKNNLQSSVNQVPSTAGMTQQSIDNYNAKKREAETEITAAQRVIDNGDATAQQISDEKHRVDNALTALNQAKHDLTADTHALEQAVQQLNRTGTTTGKKPASITAYNNSIRALQSDLTSAKNSANAIIQKPIRTVQEVQSALTNVNRVNERLTQAINQLVPLADNSALRTAKTKLDEEINKSVTTDGMTQSSIQAYENAKRAGQTETTNAQNVINNGDATDQQIAAEKTKVEEKYNSLKQAIAGLTPDLAPLQTAKTQLQNDIDQPTSTTGMTSASVAAFNDKLSAARTKIQEIDRVLASHPDVATIRQNVTAANAAKTALDQARNGLTVDKAPLENAKNQLQHSIDTQTSTTGMTQDSINAYNAKLTAARNKVQQINQVLAGSPTVDQINTNTSAANQAKSDLDHARQALTPDKAPLQNAKTQLEQSINQPTDTTGMTTASLNAYNQKLQAARQKLTEINQVLNGNPTVQNINDKVAEANQAKDQLNTARQGLTLDRQPALTTLHGASNLNQAQQNNFTQQINAAQNHAALETIKSNITALNTAMTKLKDSVADNNTIKSGQNYTDATPANKQAYDNAVNAAKGVIGETTNPTMDVNTVNQKAASVKSTKDALDGQQNLQRAKTEATNAITHASDLNQAQKNALTQQVNSAQNVQAVNDIKQTTQSLNTAMTGLKRGVANHNQVVQSDNYVNADTNKKNDYNNAYNHANDIINGNAQHPVITPSDVNNALSNVTSKEHALNGEAKLNAAKQEANTALGHLNNLNNVQRQNLQSQINGAHQIDAVNTIKQNATNLNSAMGNLRQAVADKDQVKRTEDYADADTAKQNAYNSAVSSAETIINQTANPTMSVDDVNRATSAVTTNKNALNGDEKLVQSKTDAARAIDALPHLNNAQKADVKSKINAASNIAGVNTVKQQGTDLNTAMGNLQGAINDEQTTLNSQNYQDATPSKKTAYTNAVQAAKDILNKSNGQNKTKDQVTEAMNQVNSAKNNLDGTRLLDQAKQTAKQQLNNMTHLTTAQKTNLTNQINSGTTVAGVHTVQSNANTLDQAMNTLRQSIANNDATKASEDYVDANNDKQTAYNNAVAAAETIINANSNPEMNPSTITQKAEQVNSSKTALNGDENLATAKQNAKTYLNTLTSITDAQKNNLISQISSATRVSGVDTVKQNAQHLDQAMANLQNGINNESQVKSSEKYRDADTNKQQEYDNAITAAKAILNKSTGPNTAQNAVEAALQRVNTAKDALNGDAKLIAAQNAAKQHLGTLTHITTAQRNDLTNQIS

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]