From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA1326 [new locus tag: SA_RS07520 ]
  • pan locus tag?: SAUPAN004028000
  • symbol: SA1326
  • pan gene symbol?: scpA
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA1326 [new locus tag: SA_RS07520 ]
  • symbol: SA1326
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 1534694..1535449
  • length: 756
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    ATGACGCAATACGAGGTAGATATTATGTATGAAGTTAAATTAGATGCTTTCAATGGACCA
    TTAGATTTATTGCTGCATCTTATCCAAAAATTTGAAATAGATATTTATGATATTCCTATG
    CAAGCATTAACAGAGCAGTATATGCAGTACGTTCATGCAATGAAACAGCTTGAAATTAAT
    ATTGCAAGTGAATACCTAGTATTAGCGTCAGAACTCTTAATGATTAAAAGTAAGATGCTA
    TTACCACAATCAACATCAGATATGGATGTTGATGATGACCCACGGGAAGATTTAGTTGGG
    CGTTTAATAGAATATCAAAATTATAAAGAATATACTGCTATTTTAAATGACATGAAAGAA
    GAAAGAGATTTTTATTTTACAAAAAGACCGACAGATTTATCTCATTTGGAAACAGATGAA
    TCTTGGGATCCAAATCATACGATTGATTTAACTGAATTAATTGTAGCTTATCAAAGAGTT
    AAAAATAGAGTTGAGTTAAATACACCTAAATCTGTTGAAATCCGAAAAGAGACATTTACC
    ATTCAACAAGCTACAGAACAAGTGACATCGAGATTGAAAGATAAAGATCATTTTAACTTC
    TTTAGTCTGTTTACGTTTTCTGAGCCAATTGAACAAGTAGTCACTCACTTTTTAGCTATT
    TTAGAGATGTCAAAAGCAGGAATAATTAATATTGAGCAACAACGTAATTTTGAAGATATT
    AACATTATTAGAGGAGTGAACTACCATTTTGGATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    756

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA1326 [new locus tag: SA_RS07520 ]
  • symbol: SA1326
  • description: hypothetical protein
  • length: 251
  • theoretical pI: 4.3952
  • theoretical MW: 29650.5
  • GRAVY: -0.368924

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
  • TheSEED:  
    Cell Division and Cell CycleCell Division and Cell Cycle - no subcategoryTwo cell division clusters relating to chromosome partitioning Segregation and condensation protein A 
  • PFAM:
    Kleisin (CL0157) SMC_ScpA; Segregation and condensation protein ScpA (PF02616; HMM-score: 121.8)
    Rad21_Rec8; Conserved region of Rad21 / Rec8 like protein (PF04824; HMM-score: 14.9)
    no clan definedEB1; EB1-like C-terminal motif (PF03271; HMM-score: 12.1)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.091
    • Ymax_pos: 43
    • Cmax: 0.132
    • Cmax_pos: 43
    • Smax: 0.093
    • Smax_pos: 30
    • Smean: 0.054
    • D: 0.076
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MTQYEVDIMYEVKLDAFNGPLDLLLHLIQKFEIDIYDIPMQALTEQYMQYVHAMKQLEINIASEYLVLASELLMIKSKMLLPQSTSDMDVDDDPREDLVGRLIEYQNYKEYTAILNDMKEERDFYFTKRPTDLSHLETDESWDPNHTIDLTELIVAYQRVKNRVELNTPKSVEIRKETFTIQQATEQVTSRLKDKDHFNFFSLFTFSEPIEQVVTHFLAILEMSKAGIINIEQQRNFEDINIIRGVNYHFG

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]