From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA1722 [new locus tag: SA_RS09885 ]
  • pan locus tag?: SAUPAN004935000
  • symbol: pcrB
  • pan gene symbol?: pcrB
  • synonym:
  • product: geranylgeranylglyceryl phosphate synthase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA1722 [new locus tag: SA_RS09885 ]
  • symbol: pcrB
  • product: geranylgeranylglyceryl phosphate synthase
  • replicon: chromosome
  • strand: -
  • coordinates: 1972691..1973383
  • length: 693
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    ATGTATGACATTAAAAAATGGCGCCATATTTTTAAATTAGACCCAGCTAAACATATTTCA
    GATGATGATTTAGATGCGATTTGTATGTCTCAAACAGATGCAATTATGATTGGTGGAACT
    GATGACGTTACTGAAGATAATGTCATTCATTTAATGAGCAGAATAAGAAGATACCCATTG
    CCTTTAGTACTTGAAATATCAAATATCGAAAGTGTAATGCCTGGTTTTGATTTTTATTTT
    GTACCTACAGTACTGAACAGTACAGATGTTGCATTTCACAATGGTACATTATTAGAAGCG
    CTTAAAACATATGGACATAGTATAGATTTTGAAGAAGTAATATTTGAAGGGTATGTCGTG
    TGCAATGCTGATAGCAAAGTGGCAAAACATACCAAAGCAAATACAGATTTAACAACAGAA
    GATTTAGAAGCATATGCCCAAATGGTCAATCATATGTATCGATTACCGGTTATGTATATA
    GAGTATAGTGGCATTTATGGCGACGTATCAAAGGTTCAAGCTGTCTCAGAACATCTAACA
    GAAACGCAACTTTTTTATGGTGGCGGTATTTCCTCAGAACAACAAGCGACAGAGATGGCA
    GCTATTGCAGATACAATTATCGTCGGTGATATTATTTATAAAGATATTAAAAAAGCTTTA
    AAAACAGTAAAAATAAAGGAGTCTAGTAAATGA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    693

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA1722 [new locus tag: SA_RS09885 ]
  • symbol: PcrB
  • description: geranylgeranylglyceryl phosphate synthase
  • length: 230
  • theoretical pI: 4.67385
  • theoretical MW: 25874.4
  • GRAVY: -0.103913

Function[edit source | edit]

  • reaction:
    EC 2.5.1.n9?  ExPASy
    Heptaprenylglyceryl phosphate synthaseAll-trans-heptaprenyl diphosphate + sn-glycerol 1-phosphate = diphosphate + sn-3-O-(all-trans-heptaprenyl)glycerol 1-phosphate
  • TIGRFAM:
    phosphoglycerol geranylgeranyltransferase (TIGR04146; EC 2.5.1.41; HMM-score: 245.9)
    geranylgeranylglyceryl phosphate synthase family protein (TIGR01768; EC 2.5.1.-; HMM-score: 205.1)
    phosphoglycerol geranylgeranyltransferase, putative (TIGR04147; EC 2.5.1.41; HMM-score: 187.7)
    phosphoglycerol geranylgeranyltransferase (TIGR01769; EC 2.5.1.41; HMM-score: 48.1)
    HAD superfamily (subfamily IG) hydrolase, 5'-nucleotidase (TIGR02244; HMM-score: 17.3)
  • TheSEED:  
    Archaeal lipids Heptaprenylglyceryl phosphate synthase (EC 2.5.1.n9) 
    CBSS-393121.3.peg.1913 Heptaprenylglyceryl phosphate synthase (EC 2.5.1.n9) 
  • PFAM:
    TIM_barrel (CL0036) PcrB; PcrB family (PF01884; HMM-score: 233.3)
    Trp_syntA; Tryptophan synthase alpha chain (PF00290; HMM-score: 21.8)
    HAD (CL0137) 5_nucleotid; 5' nucleotidase family (PF05761; HMM-score: 13.8)
    TIM_barrel (CL0036) His_biosynth; Histidine biosynthesis protein (PF00977; HMM-score: 13.2)
    no clan definedPox_H7; Late protein H7 (PF04787; HMM-score: 12.8)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors: Mg2+
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.092
    • Ymax_pos: 70
    • Cmax: 0.109
    • Cmax_pos: 46
    • Smax: 0.134
    • Smax_pos: 2
    • Smean: 0.064
    • D: 0.081
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MYDIKKWRHIFKLDPAKHISDDDLDAICMSQTDAIMIGGTDDVTEDNVIHLMSRIRRYPLPLVLEISNIESVMPGFDFYFVPTVLNSTDVAFHNGTLLEALKTYGHSIDFEEVIFEGYVVCNADSKVAKHTKANTDLTTEDLEAYAQMVNHMYRLPVMYIEYSGIYGDVSKVQAVSEHLTETQLFYGGGISSEQQATEMAAIADTIIVGDIIYKDIKKALKTVKIKESSK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]