From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA1887 [new locus tag: SA_RS10855 ]
  • pan locus tag?: SAUPAN005356000
  • symbol: ddl
  • pan gene symbol?: ddl
  • synonym:
  • product: D-alanyl-alanine synthetase A

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA1887 [new locus tag: SA_RS10855 ]
  • symbol: ddl
  • product: D-alanyl-alanine synthetase A
  • replicon: chromosome
  • strand: -
  • coordinates: 2139312..2140382
  • length: 1071
  • essential: yes DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    ATGACAAAAGAAAATATTTGTATCGTTTTTGGAGGGAAAAGTGCAGAACACGAAGTATCG
    ATTCTGACAGCACAAAATGTATTAAATGCAATAGATAAAGACAAATATCATGTTGATATC
    ATTTATATTACCAATGATGGTGATTGGAGAAAGCAAAATAATATTACAGCTGAAATTAAA
    TCTACTGATGAGCTTCATTTAGAAAATGGAGAGGCGCTTGAGATTTCACAGCTATTGAAA
    GAAAGTAGTTCAGGACAACCATACGATGCAGTATTCCCATTATTACATGGTCCTAATGGT
    GAAGATGGCACGATTCAAGGGCTTTTTGAAGTTTTGGATGTACCATATGTAGGAAATGGT
    GTATTGTCAGCTGCAAGTTCTATGGACAAACTTGTAATGAAACAATTATTTGAACATCGA
    GGGTTACCACAGTTACCTTATATTAGTTTCTTACGTTCTGAATATGAAAAATATGAACAT
    AACATTTTAAAATTAGTAAATGATAAATTAAATTACCCAGTCTTTGTTAAACCTGCTAAC
    TTAGGGTCAAGTGTAGGTATCAGTAAATGTAATAATGAAGCGGAACTTAAAGAAGGTATT
    AAAGAAGCATTCCAATTTGACCGTAAGCTTGTTATAGAACAAGGCGTTAACGCACGTGAA
    ATTGAAGTAGCAGTTTTAGGAAATGACTATCCTGAAGCGACATGGCCAGGTGAAGTCGTA
    AAAGATGTCGCGTTTTACGATTACAAATCAAAATATAAAGATGGTAAGGTTCAATTACAA
    ATTCCAGCTGACTTAGACGAAGATGTTCAATTAACGCTTAGAAATATGGCATTAGAGGCA
    TTCAAAGCGACAGATTGTTCTGGTTTAGTCCGTGCTGATTTCTTTGTAACAGAAGACAAC
    CAAATATATATTAATGAAACAAATGCAATGCCTGGATTTACGGCTTTCAGTATGTATCCA
    AAGTTATGGGAAAATATGGGCTTATCTTATCCAGAATTGATTACAAAACTTATCGAGCTT
    GCTAAAGAACGTCACCAGGATAAACAGAAAAATAAATACAAAATTGACTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1071

Protein[edit source | edit]

Protein Data Bank: 2I80
Protein Data Bank: 2I87
Protein Data Bank: 2I8C
Protein Data Bank: 3N8D

General[edit source | edit]

  • locus tag: SA1887 [new locus tag: SA_RS10855 ]
  • symbol: Ddl
  • description: D-alanyl-alanine synthetase A
  • length: 356
  • theoretical pI: 4.63245
  • theoretical MW: 40230.3
  • GRAVY: -0.394663

Function[edit source | edit]

  • reaction:
    EC 6.3.2.4?  ExPASy
    D-alanine--D-alanine ligaseATP + 2 D-alanine = ADP + phosphate + D-alanyl-D-alanine
  • TIGRFAM:
    Cell structureCell envelopeBiosynthesis and degradation of murein sacculus and peptidoglycanD-alanine--D-alanine ligase (TIGR01205; EC 6.3.2.4; HMM-score: 368.6)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesPurine ribonucleotide biosynthesisphosphoribosylaminoimidazole carboxylase, ATPase subunit (TIGR01161; EC 4.1.1.21; HMM-score: 33.5)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesPyrimidine ribonucleotide biosynthesiscarbamoyl-phosphate synthase, large subunit (TIGR01369; EC 6.3.5.5; HMM-score: 21.7)
    alpha-L-glutamate ligase, RimK family (TIGR00768; EC 6.3.2.-; HMM-score: 21.2)
    MetabolismFatty acid and phospholipid metabolismBiosynthesisacetyl-CoA carboxylase, biotin carboxylase subunit (TIGR00514; EC 6.3.4.14; HMM-score: 20.9)
    MetabolismCentral intermediary metabolismNitrogen metabolismurea carboxylase (TIGR02712; EC 6.3.4.6; HMM-score: 20.4)
    MetabolismAmino acid biosynthesisOtherpyrrolysine biosynthesis protein PylC (TIGR03909; HMM-score: 17.1)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOthercoenzyme gamma-F420-2:alpha-L-glutamate ligase (TIGR04443; EC 6.3.2.32; HMM-score: 15.2)
    Cellular processesCellular processesBiosynthesis of natural productscyanophycin synthetase (TIGR02068; EC 6.3.2.29,6.3.2.30; HMM-score: 13.8)
  • TheSEED:  
    Cell Wall and CapsuleCell Wall and Capsule - no subcategoryPeptidoglycan Biosynthesis D-alanine--D-alanine ligase (EC 6.3.2.4) 
    Cell Wall and Capsule - no subcategoryPeptidoglycan biosynthesis--gjo D-alanine--D-alanine ligase (EC 6.3.2.4) 
    cell division cluster containing FtsQ D-alanine--D-alanine ligase (EC 6.3.2.4) 
  • PFAM:
    ATP-grasp (CL0179) Dala_Dala_lig_C; D-ala D-ala ligase C-terminus (PF07478; HMM-score: 258.2)
    PreATP-grasp (CL0483) Dala_Dala_lig_N; D-ala D-ala ligase N-terminus (PF01820; HMM-score: 109.7)
    ATP-grasp (CL0179) ATP-grasp; ATP-grasp domain (PF02222; HMM-score: 34.4)
    CPSase_L_D2; Carbamoyl-phosphate synthase L chain, ATP binding domain (PF02786; HMM-score: 29.3)
    ATP-grasp_4; ATP-grasp domain (PF13535; HMM-score: 21.2)
    ATPgrasp_ST; Sugar-transfer associated ATP-grasp (PF14397; HMM-score: 14.8)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors: Mg2+, Mn2+
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.142
    • Ymax_pos: 31
    • Cmax: 0.134
    • Cmax_pos: 31
    • Smax: 0.211
    • Smax_pos: 21
    • Smean: 0.137
    • D: 0.14
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MTKENICIVFGGKSAEHEVSILTAQNVLNAIDKDKYHVDIIYITNDGDWRKQNNITAEIKSTDELHLENGEALEISQLLKESSSGQPYDAVFPLLHGPNGEDGTIQGLFEVLDVPYVGNGVLSAASSMDKLVMKQLFEHRGLPQLPYISFLRSEYEKYEHNILKLVNDKLNYPVFVKPANLGSSVGISKCNNEAELKEGIKEAFQFDRKLVIEQGVNAREIEVAVLGNDYPEATWPGEVVKDVAFYDYKSKYKDGKVQLQIPADLDEDVQLTLRNMALEAFKATDCSGLVRADFFVTEDNQIYINETNAMPGFTAFSMYPKLWENMGLSYPELITKLIELAKERHQDKQKNKYKID

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]