From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA1988 [new locus tag: SA_RS11450 ]
  • pan locus tag?: SAUPAN005582000
  • symbol: SA1988
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA1988 [new locus tag: SA_RS11450 ]
  • symbol: SA1988
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 2259001..2260008
  • length: 1008
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    ATGAAAATGATAGGATTTGAAAAGCCCTTTAAATTGGAAGAAGGAAATTTATTTAAAGTA
    TACGAACAAAGAAAGCCAACGCCAGAAAACGATGATATCTTAGTCAAAGTAAATAGTATT
    AGTGTAAATCCTGTAGATACAAAACAACGTCAAATGAAAGTCACTCAAGCACCTCGTGTA
    CTTGGGTTTGATGCTATTGGTACTGTTGAAGCTATCGGACCAGACGTTACATTATTTAGT
    CCGGGTGACGTTGTATTTTATGCTGGATCGCCAAATAGACAAGGATCAAATGCGACATAT
    CAATTGGTGTCAGAAGCTATAGTTGCAAAGGCACCACACAACATAAGTGCTAATGAAGCG
    GTTAGTCTACCGCTAACTGGTATTACGGCATATGAAACGTTTTTTGATACATTTAAAATT
    TCACATAATCCTTCTGAAAATGTAGGTAAATCCGTGTTAATCATTAATGGTGCCGGTGGT
    GTAGGCAGTATAGCCACTCAAATTGCTAAACGGTATGGTTTAACTGTCATTACAACAGCA
    TCACGACAAGAAACAACAGAGTGGTGTGAAAAGATGGGCGCAGATATCGTATTGAATCAT
    AAAGAGGATTTAGTGCGTCAATTTAAAGAAAAAGAAATTCCATTAGTAGATTATATATTT
    TGCACTTATAATACAGACTTGTATTACAATACTATGATTGAACTGATAAAACCATTAGGG
    CATATTACGACTATCGTAGCTTTTAATGAAGATCAAGATTTAAATGCATTAAAATTAAAA
    AGTATAACATTTACACATGAATTTATGTTTGCGCGTCCAATTCATCGAACGCCTGATATG
    ATTAAACAACATGAGTATTTAGAAGATATTACGAAAAATATAGAATTAGGGCATTACCAA
    CCAACAACGACACAAGTTTTTGAAGGTTTATCACCTGAAAACTTATATCAAGCACATCAA
    TTGTTGGAAAAACAATCAATGATTGGGAAATTAGTAATTAATATATAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1008

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA1988 [new locus tag: SA_RS11450 ]
  • symbol: SA1988
  • description: hypothetical protein
  • length: 335
  • theoretical pI: 5.84004
  • theoretical MW: 37573.7
  • GRAVY: -0.222388

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    MetabolismEnergy metabolismFermentationzinc-binding alcohol dehydrogenase family protein (TIGR02817; HMM-score: 329.4)
    Unknown functionEnzymes of unknown specificityputative NAD(P)H quinone oxidoreductase, PIG3 family (TIGR02824; HMM-score: 138.3)
    crotonyl-CoA carboxylase/reductase (TIGR01751; EC 1.3.1.85; HMM-score: 69.2)
    Unknown functionEnzymes of unknown specificityputative quinone oxidoreductase, YhdH/YhfP family (TIGR02823; HMM-score: 68.9)
    MetabolismEnergy metabolismAmino acids and aminesL-threonine 3-dehydrogenase (TIGR00692; EC 1.1.1.103; HMM-score: 39.9)
    leukotriene B4 12-hydroxydehydrogenase/15-oxo-prostaglandin 13-reductase (TIGR02825; EC 1.3.1.48,1.3.1.74; HMM-score: 37.9)
    Cellular processesCellular processesDetoxificationS-(hydroxymethyl)mycothiol dehydrogenase (TIGR03451; EC 1.1.1.306; HMM-score: 36.4)
    6-hydroxycyclohex-1-ene-1-carbonyl-CoA dehydrogenase (TIGR03201; EC 1.1.1.-; HMM-score: 31.9)
    Unknown functionEnzymes of unknown specificityNDMA-dependent alcohol dehydrogenase, Rxyl_3153 family (TIGR03989; EC 1.1.99.36; HMM-score: 29.9)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersChlorophyll and bacteriochlorphyllchlorophyll synthesis pathway protein BchC (TIGR01202; HMM-score: 26.1)
    putative phosphonate catabolism associated alcohol dehydrogenase (TIGR03366; HMM-score: 19.8)
    Cellular processesCellular processesDetoxificationS-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase (TIGR02818; EC 1.1.1.1,1.1.1.284; HMM-score: 18.5)
    MetabolismEnergy metabolismFermentationS-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase (TIGR02818; EC 1.1.1.1,1.1.1.284; HMM-score: 18.5)
    MetabolismEnergy metabolismFermentationzinc-binding alcohol dehydrogenase family protein (TIGR02822; EC 1.-.-.-; HMM-score: 18.4)
    acetyl coenzyme A synthetase (ADP forming), alpha domain (TIGR02717; EC 6.2.1.13; HMM-score: 13.5)
  • TheSEED:  
    Bifunctional protein: zinc-containing alcohol dehydrogenase 
    quinone oxidoreductase ( NADPH:quinone reductase) (EC 1.1.1.-) 
    Similar to arginate lyase 
  • PFAM:
    NADP_Rossmann (CL0063) ADH_zinc_N; Zinc-binding dehydrogenase (PF00107; HMM-score: 54.1)
    ADH_zinc_N_2; Zinc-binding dehydrogenase (PF13602; HMM-score: 45.8)
    GroES (CL0296) ADH_N; Alcohol dehydrogenase GroES-like domain (PF08240; HMM-score: 29.6)
    NADP_Rossmann (CL0063) AlaDh_PNT_C; Alanine dehydrogenase/PNT, C-terminal domain (PF01262; HMM-score: 18.1)
    2-Hacid_dh_C; D-isomer specific 2-hydroxyacid dehydrogenase, NAD binding domain (PF02826; HMM-score: 13.1)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.123
    • Ymax_pos: 11
    • Cmax: 0.114
    • Cmax_pos: 51
    • Smax: 0.244
    • Smax_pos: 2
    • Smean: 0.134
    • D: 0.127
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MKMIGFEKPFKLEEGNLFKVYEQRKPTPENDDILVKVNSISVNPVDTKQRQMKVTQAPRVLGFDAIGTVEAIGPDVTLFSPGDVVFYAGSPNRQGSNATYQLVSEAIVAKAPHNISANEAVSLPLTGITAYETFFDTFKISHNPSENVGKSVLIINGAGGVGSIATQIAKRYGLTVITTASRQETTEWCEKMGADIVLNHKEDLVRQFKEKEIPLVDYIFCTYNTDLYYNTMIELIKPLGHITTIVAFNEDQDLNALKLKSITFTHEFMFARPIHRTPDMIKQHEYLEDITKNIELGHYQPTTTQVFEGLSPENLYQAHQLLEKQSMIGKLVINI

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]

Alexander Scherl, Patrice François, Manuela Bento, Jacques M Deshusses, Yvan Charbonnier, Véronique Converset, Antoine Huyghe, Nadia Walter, Christine Hoogland, Ron D Appel, Jean-Charles Sanchez, Catherine G Zimmermann-Ivol, Garry L Corthals, Denis F Hochstrasser, Jacques Schrenzel
Correlation of proteomic and transcriptomic profiles of Staphylococcus aureus during the post-exponential phase of growth.
J. Microbiol. Methods: 2005, 60(2);247-57
[PubMed:15590099] [WorldCat.org] [DOI] (P p)