From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA2149 [new locus tag: SA_RS12345 ]
  • pan locus tag?: SAUPAN005868000
  • symbol: SA2149
  • pan gene symbol?: hrtA
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA2149 [new locus tag: SA_RS12345 ]
  • symbol: SA2149
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 2415058..2415723
  • length: 666
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    ATGGCATTAGTCGTTAAAGATATCGTCAAAAATTTCGGAGAAGGTTTGTCTGAAACAAAA
    GTTTTAAAAGGTATTAATTTTGAAGTGGAACAAGGGGAATTTGTCATTTTAAATGGTGCC
    TCTGGTTCTGGGAAAACAACATTGCTAACGATATTAGGCGGATTGTTAAGTCAAACGAGT
    GGTACAGTGCTTTACAATGATGCACCATTGTTTGATAAACAGCATCGTCCTAGTGATTTG
    CGATTGGAAGATATTGGTTTTATTTTTCAATCTTCACATTTAGTTCCTTATTTAAAAGTG
    ATAGAGCAATTGACACTCGTAGGCCAAGAAGCGGGAATGACCAAACAACAAAGTTCAACA
    AGAGCAATACAACTTTTGAAAAATATTGGGTTAGAAGATCGCTTGAATGTATATCCGCAT
    CAGTTATCTGGCGGTGAAAAGCAACGTGTTGCGATTATGAGAGCATTTATGAATAATCCG
    AAAATCATTTTAGCAGATGAGCCCACAGCAAGTTTAGATGCCGATAGAGCAACAAAAGTT
    GTTGAGATGATACGTCAACAAATTAAAGAACAACAAATGATTGGTATTATGATTACACAC
    GATCGAAGATTATTTGAATATGCAGATCGAGTGATTGAATTAGAAGATGGCAAAATAACT
    GATTAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    666

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA2149 [new locus tag: SA_RS12345 ]
  • symbol: SA2149
  • description: hypothetical protein
  • length: 221
  • theoretical pI: 5.72211
  • theoretical MW: 24625.2
  • GRAVY: -0.158371

Function[edit source | edit]

  • reaction:
    EC 3.6.3.-?  ExPASy
  • TIGRFAM:
    ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 212.9)
    Genetic information processingProtein fateProtein and peptide secretion and traffickinglipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 199.5)
    Cellular processesCellular processesToxin production and resistanceputative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 175.5)
    MetabolismTransport and binding proteinsUnknown substrateputative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 175.5)
    Cellular processesCellular processesCell divisioncell division ATP-binding protein FtsE (TIGR02673; HMM-score: 160)
    MetabolismTransport and binding proteinsAnionsphosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 156.9)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesputative 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TIGR03265; HMM-score: 155.6)
    ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 144.8)
    MetabolismTransport and binding proteinsUnknown substrateenergy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 140.7)
    MetabolismTransport and binding proteinsAnionssulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 139.2)
    thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 135.9)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesglycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 134.3)
    MetabolismTransport and binding proteinsUnknown substrateenergy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 131.7)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system (TIGR03864; HMM-score: 131.2)
    MetabolismTransport and binding proteinsAnionsmolybdate ABC transporter, ATP-binding protein (TIGR02142; EC 3.6.3.29; HMM-score: 126.9)
    2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 121)
    phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 120.5)
    Cellular processesCellular processesPathogenesistype I secretion system ATPase (TIGR03375; HMM-score: 113.7)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype I secretion system ATPase (TIGR03375; HMM-score: 113.7)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminespolyamine ABC transporter, ATP-binding protein (TIGR01187; EC 3.6.3.31; HMM-score: 113.3)
    MetabolismTransport and binding proteinsOtherdaunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 109.9)
    D-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 109.3)
    MetabolismTransport and binding proteinsCations and iron carrying compoundsnickel import ATP-binding protein NikD (TIGR02770; HMM-score: 109.2)
    MetabolismTransport and binding proteinsOtherthiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 108.8)
    MetabolismTransport and binding proteinsCations and iron carrying compoundsnickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 108.6)
    MetabolismTransport and binding proteinsAnionsphosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 107.7)
    MetabolismTransport and binding proteinsAnionsnitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 107.6)
    MetabolismTransport and binding proteinsOthernitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 107.6)
    MetabolismTransport and binding proteinsCations and iron carrying compoundscobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 107.5)
    thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 106.9)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingheme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 104.7)
    MetabolismTransport and binding proteinsOtherheme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 104.7)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesLPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 102.2)
    MetabolismTransport and binding proteinsOtherLPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 102.2)
    MetabolismEnergy metabolismMethanogenesismethyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 101.6)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminescholine ABC transporter, ATP-binding protein (TIGR03415; HMM-score: 97.5)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype I secretion system ATPase (TIGR01842; HMM-score: 97.1)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesurea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 96.9)
    MetabolismTransport and binding proteinsOtherpigment precursor permease (TIGR00955; HMM-score: 93.4)
    ABC transporter, permease/ATP-binding protein (TIGR02204; HMM-score: 91.4)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharideslipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 89.1)
    MetabolismTransport and binding proteinsOtherlipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 89.1)
    Cellular processesCellular processesBiosynthesis of natural productsNHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 88.8)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesNHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 88.8)
    gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 88.7)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesurea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 86.6)
    proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 85.6)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsD-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 85.4)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype I secretion system ATPase (TIGR01846; HMM-score: 85.2)
    lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 83.3)
    Cellular processesCellular processesBiosynthesis of natural productsNHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 83.3)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesNHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 83.3)
    MetabolismTransport and binding proteinsOtherantigen peptide transporter 2 (TIGR00958; HMM-score: 81.3)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminescyclic peptide transporter (TIGR01194; HMM-score: 78.8)
    MetabolismTransport and binding proteinsOthercyclic peptide transporter (TIGR01194; HMM-score: 78.8)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingABC-type bacteriocin transporter (TIGR01193; HMM-score: 76.9)
    Genetic information processingProtein fateProtein modification and repairABC-type bacteriocin transporter (TIGR01193; HMM-score: 76.9)
    MetabolismTransport and binding proteinsOtherABC-type bacteriocin transporter (TIGR01193; HMM-score: 76.9)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOtherFeS assembly ATPase SufC (TIGR01978; HMM-score: 75.8)
    Cellular processesCellular processesOthernodulation ABC transporter NodI (TIGR01288; HMM-score: 71)
    MetabolismTransport and binding proteinsOthernodulation ABC transporter NodI (TIGR01288; HMM-score: 71)
    ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 69.8)
    MetabolismTransport and binding proteinsUnknown substrateanchored repeat-type ABC transporter, ATP-binding subunit (TIGR03771; HMM-score: 65.6)
    MetabolismCentral intermediary metabolismPhosphorus compoundsphosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 63.2)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsglucan exporter ATP-binding protein (TIGR01192; EC 3.6.3.42; HMM-score: 59.8)
    MetabolismTransport and binding proteinsOtherrim ABC transporter (TIGR01257; HMM-score: 56.7)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsperoxysomal long chain fatty acyl transporter (TIGR00954; HMM-score: 48.2)
    MetabolismTransport and binding proteinsOtherpleiotropic drug resistance family protein (TIGR00956; HMM-score: 43.6)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairexcinuclease ABC subunit A (TIGR00630; EC 3.1.25.-; HMM-score: 42)
    MetabolismTransport and binding proteinsAnionscystic fibrosis transmembrane conductor regulator (CFTR) (TIGR01271; EC 3.6.3.49; HMM-score: 37.2)
    MetabolismTransport and binding proteinsOthermulti drug resistance-associated protein (MRP) (TIGR00957; HMM-score: 36.7)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesNucleotide and nucleoside interconversionsdTMP kinase (TIGR00041; EC 2.7.4.9; HMM-score: 21.5)
    helicase/secretion neighborhood ATPase (TIGR03819; HMM-score: 19.1)
    Cellular processesCellular processesCell divisionchromosome segregation protein SMC (TIGR02169; HMM-score: 18.9)
    Genetic information processingDNA metabolismChromosome-associated proteinschromosome segregation protein SMC (TIGR02169; HMM-score: 18.9)
    rad50 (TIGR00606; HMM-score: 18.7)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesSalvage of nucleosides and nucleotidesuridine kinase (TIGR00235; EC 2.7.1.48; HMM-score: 15.2)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA threonylcarbamoyl adenosine modification protein YjeE (TIGR00150; HMM-score: 13.7)
    Genetic information processingDNA metabolismRestriction/modificationDNA sulfur modification protein DndD (TIGR03185; HMM-score: 12.5)
    P-type DNA transfer ATPase VirB11 (TIGR02788; HMM-score: 12.3)
    type IV secretion/conjugal transfer ATPase, VirB4 family (TIGR00929; HMM-score: 10.7)
  • TheSEED:  
    Iron acquisition and metabolismIron acquisition and metabolism - no subcategoryHeme, hemin uptake and utilization systems in GramPositives Heme efflux system ATPase HrtA 
  • PFAM:
    P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 112.2)
    SMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 37.4)
    AAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 29)
    CbiA; CobQ/CobB/MinD/ParA nucleotide binding domain (PF01656; HMM-score: 25.2)
    AAA_16; AAA ATPase domain (PF13191; HMM-score: 23.1)
    AAA_18; AAA domain (PF13238; HMM-score: 18.6)
    AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 18.4)
    AAA_13; AAA domain (PF13166; HMM-score: 16.9)
    AAA_25; AAA domain (PF13481; HMM-score: 16.4)
    NACHT; NACHT domain (PF05729; HMM-score: 15.6)
    AAA_33; AAA domain (PF13671; HMM-score: 15.5)
    AAA_30; AAA domain (PF13604; HMM-score: 14.9)
    T2SSE; Type II/IV secretion system protein (PF00437; HMM-score: 14.8)
    AAA_22; AAA domain (PF13401; HMM-score: 14.8)
    IstB_IS21; IstB-like ATP binding protein (PF01695; HMM-score: 14.6)
    RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 14.6)
    cobW; CobW/HypB/UreG, nucleotide-binding domain (PF02492; HMM-score: 13.8)
    CPT; Chloramphenicol phosphotransferase-like protein (PF07931; HMM-score: 13.4)
    AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 13)
    SbcCD_C; Putative exonuclease SbcCD, C subunit (PF13558; HMM-score: 12.8)
    AAA_23; AAA domain (PF13476; HMM-score: 12.7)
    TsaE; Threonylcarbamoyl adenosine biosynthesis protein TsaE (PF02367; HMM-score: 12.1)
    AAA_15; AAA ATPase domain (PF13175; HMM-score: 12)
    Zeta_toxin; Zeta toxin (PF06414; HMM-score: 11.6)
    AAA_28; AAA domain (PF13521; HMM-score: 10.4)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.04
    • Cytoplasmic Membrane Score: 9.96
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 0.67
    • Signal Peptide Possibility: -0.5
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.128
    • Ymax_pos: 18
    • Cmax: 0.122
    • Cmax_pos: 43
    • Smax: 0.207
    • Smax_pos: 11
    • Smean: 0.147
    • D: 0.136
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MALVVKDIVKNFGEGLSETKVLKGINFEVEQGEFVILNGASGSGKTTLLTILGGLLSQTSGTVLYNDAPLFDKQHRPSDLRLEDIGFIFQSSHLVPYLKVIEQLTLVGQEAGMTKQQSSTRAIQLLKNIGLEDRLNVYPHQLSGGEKQRVAIMRAFMNNPKIILADEPTASLDADRATKVVEMIRQQIKEQQMIGIMITHDRRLFEYADRVIELEDGKITD

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator: SA2151 (HssR*)
    HssR* (TF) important in Heme efflux  RegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]