From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA2162 [new locus tag: SA_RS12410 ]
  • pan locus tag?: SAUPAN005890000
  • symbol: SA2162
  • pan gene symbol?: iruO
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA2162 [new locus tag: SA_RS12410 ]
  • symbol: SA2162
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 2428800..2429795
  • length: 996
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    TTGTATGCAAGCTTTTATGCTGGATTGCGAGATATGTCTGTAAGATTGATAGATGTTCAA
    TCTGAATTAGGGGGTAAGATGAGAATTTACCCTGAAAAAATTATTTGGGATATTGGCGGC
    ATTGCGCCAAAACCTTGTCATGAAATTTTAAAAGATACAATTAAGCAAGGATTATATTTT
    AAACCGGAAGTTCATTTGAATGAACGTGTGGTAGATATTAGGAAAAAGGCAGAACGTCAT
    TTCGAAGTTGAAACAGAAGCGGGAGAAATATATACATCGAAAGCAGTTATCATTGCAATT
    GGTGCGGGTATTATTAATCCAAAACAATTAGATGTTAAAGGTGTAGAGAGATATCAATTA
    ACTAATTTACATTATGTTGTACAAAGTTACAGACGTTTCAAAGATAAAGATGTATTAATA
    TCAGGTGGAGGAAATACAGCATTAGATTGGGCGCATGATATTGCCAAGATTGCTAAAAGC
    GTGACAGTTGTTTATCGAAAAGAAGATGTAAGTGGTCATGAAGCGATGAAAACGTTGGTG
    ACAGATTTAAATGTGAAACTATGCCCAAAAACACGTATTAAATACTTGGTCGGCAATGAT
    GATGAAACGCATATAAGTGAAGTTGTTTTGGAACATGTTGAAAGTGGCGATAGGCATACA
    GTTAAATTTGACGATGTCATTATTAGTCATGGGTTTGATCGTTGTAATACATTATTGAGT
    GAAACATCTTCAAAGCTAGATATGCATGATGATTGTCGTGTTAAAGGATTTGGTAATACG
    ACAACTAGTATACCTGGTATCTATGCGTGTGGAGATATTGTTTATCATGATGCAAAATCA
    CATCTAATTGCAAGTGCATTTAGTGATGGTGCAAATGCAGCGAACCTTGCTAAAACATAT
    ATCCAACCAGATGCGAATGCAGAGGGTTATGTTTCAAGTCATCATGAAGTGTTTAAAGAA
    GCGAATAAGACTATTGTAAATAAACATTTATACTAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    996

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA2162 [new locus tag: SA_RS12410 ]
  • symbol: SA2162
  • description: hypothetical protein
  • length: 331
  • theoretical pI: 6.95906
  • theoretical MW: 37033.9
  • GRAVY: -0.305136

Function[edit source | edit]

  • reaction:
    EC 1.18.1.2?  ExPASy
    Ferredoxin--NADP+ reductase2 reduced ferredoxin + NADP+ + H+ = 2 oxidized ferredoxin + NADPH
  • TIGRFAM:
    MetabolismEnergy metabolismElectron transportthioredoxin-disulfide reductase (TIGR01292; EC 1.8.1.9; HMM-score: 108.3)
    Cellular processesCellular processesDetoxificationalkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 77.1)
    Cellular processesCellular processesAdaptations to atypical conditionsalkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 77.1)
    Unknown functionEnzymes of unknown specificityputative bacillithiol system oxidoreductase, YpdA family (TIGR04018; EC 1.8.-.-; HMM-score: 66.3)
    putative alkyl hydroperoxide reductase F subunit (TIGR03143; EC 1.6.4.-; HMM-score: 66)
    MetabolismAmino acid biosynthesisGlutamate familyglutamate synthase (NADPH), homotetrameric (TIGR01316; EC 1.4.1.13; HMM-score: 46)
    dihydrolipoyl dehydrogenase (TIGR01350; EC 1.8.1.4; HMM-score: 42)
    mycothione reductase (TIGR03452; EC 1.8.1.15; HMM-score: 36.5)
    Cellular processesCellular processesDetoxificationmercury(II) reductase (TIGR02053; EC 1.16.1.1; HMM-score: 35)
    Cellular processesCellular processesDetoxificationCoA-disulfide reductase (TIGR03385; EC 1.8.1.14; HMM-score: 34.4)
    glutamate synthase, small subunit (TIGR01318; HMM-score: 28.9)
    MetabolismEnergy metabolismElectron transportglutathione-disulfide reductase (TIGR01424; EC 1.8.1.7; HMM-score: 28.3)
    putative selenate reductase, YgfK subunit (TIGR03315; HMM-score: 27.9)
    thioredoxin and glutathione reductase (TIGR01438; EC 1.6.4.-; HMM-score: 26.7)
    glutamate synthase, NADH/NADPH, small subunit (TIGR01317; EC 1.4.1.-; HMM-score: 26.3)
    MetabolismEnergy metabolismElectron transportglutathione-disulfide reductase (TIGR01421; EC 1.8.1.7; HMM-score: 21)
    Unknown functionEnzymes of unknown specificityflavoprotein, HI0933 family (TIGR00275; HMM-score: 19.7)
    flavin-dependent oxidoreductase, MSMEG_0569 family (TIGR04046; HMM-score: 15.6)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersChlorophyll and bacteriochlorphyllgeranylgeranyl reductase family (TIGR02032; EC 1.3.1.-; HMM-score: 12.5)
  • TheSEED:  
    Nucleosides and NucleotidesPyrimidinespyrimidine conversions Thioredoxin reductase (EC 1.8.1.9) 
    Sulfur MetabolismSulfur Metabolism - no subcategoryThioredoxin-disulfide reductase Thioredoxin reductase (EC 1.8.1.9) 
  • PFAM:
    NADP_Rossmann (CL0063) Pyr_redox_2; Pyridine nucleotide-disulphide oxidoreductase (PF07992; HMM-score: 85.6)
    Pyr_redox_3; Pyridine nucleotide-disulphide oxidoreductase (PF13738; HMM-score: 77.7)
    Pyr_redox; Pyridine nucleotide-disulphide oxidoreductase (PF00070; HMM-score: 41.3)
    K_oxygenase; L-lysine 6-monooxygenase (NADPH-requiring) (PF13434; HMM-score: 29.9)
    Amino_oxidase; Flavin containing amine oxidoreductase (PF01593; HMM-score: 19.5)
    HI0933_like; HI0933-like protein (PF03486; HMM-score: 17)
    NAD_binding_7; Putative NAD(P)-binding (PF13241; HMM-score: 16.1)
    FMO-like; Flavin-binding monooxygenase-like (PF00743; HMM-score: 14.7)
    NAD_binding_9; FAD-NAD(P)-binding (PF13454; HMM-score: 14.4)
    FAD_binding_2; FAD binding domain (PF00890; HMM-score: 12.8)
    DAO; FAD dependent oxidoreductase (PF01266; HMM-score: 12.6)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors: FAD
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.097
    • Ymax_pos: 11
    • Cmax: 0.108
    • Cmax_pos: 22
    • Smax: 0.163
    • Smax_pos: 1
    • Smean: 0.08
    • D: 0.091
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MYASFYAGLRDMSVRLIDVQSELGGKMRIYPEKIIWDIGGIAPKPCHEILKDTIKQGLYFKPEVHLNERVVDIRKKAERHFEVETEAGEIYTSKAVIIAIGAGIINPKQLDVKGVERYQLTNLHYVVQSYRRFKDKDVLISGGGNTALDWAHDIAKIAKSVTVVYRKEDVSGHEAMKTLVTDLNVKLCPKTRIKYLVGNDDETHISEVVLEHVESGDRHTVKFDDVIISHGFDRCNTLLSETSSKLDMHDDCRVKGFGNTTTSIPGIYACGDIVYHDAKSHLIASAFSDGANAANLAKTYIQPDANAEGYVSSHHEVFKEANKTIVNKHLY

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator: SA1329 (Fur*)
    Fur* (TF) important in Iron homeostasis  RegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]