From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA2499 [new locus tag: SA_RS14290 ]
  • pan locus tag?: SAUPAN006487000
  • symbol: gidB
  • pan gene symbol?: gidB
  • synonym:
  • product: 16S rRNA methyltransferase GidB

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA2499 [new locus tag: SA_RS14290 ]
  • symbol: gidB
  • product: 16S rRNA methyltransferase GidB
  • replicon: chromosome
  • strand: -
  • coordinates: 2809792..2810511
  • length: 720
  • essential: yes DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    ATGACTGTAGAATGGTTAGCAGAACAATTAAAAGAACATAATATTGAATTAACTGAGACT
    CAAAAACAACAGTTTCAAACATATTATCGTTTACTTGTTGAATGGAATGAAAAGATGAAT
    TTGACAAGTATTACAGATGAACACGATGTATATTTGAAACATTTTTATGATTCCATTGCA
    CCTAGTTTTTATTTTGATTTTAATCAGCCTATAAGTATATGTGATGTAGGCGCTGGAGCT
    GGTTTTCCAAGTATTCCGTTAAAAATAATGTTTCCGCAGTTAAAAGTGACGATTGTTGAT
    TCATTAAATAAGCGTATTCAATTTTTAAACCATTTAGCGTCAGAATTACAATTACAGGAT
    GTCAGCTTTATACACGATAGAGCAGAAACATTTGGTAAGGGTGTCTACAGGGAGTCTTAT
    GATGTTGTTACTGCAAGAGCAGTAGCTAGATTATCCGTGTTGAGTGAATTGTGTTTACCG
    CTAATTAAAAAAGGTGGACAGTTTGTTGCATTAAAATCTTCAAAAGGTGAAGAAGAATTA
    GAAGAAGCAAAATTTGCAATTAGTGTGTTAGGTGGTAACGTTACAGAAACACATACCTTT
    AAATTGCCAGAAGATGCTGGAGAGCGCCAGATGTTCATTATTGATAAAAAAAGACAGACG
    CCGAAAAAGTACCCAAGAAAACCAGGGACGCCTAATAAGACTCCTTTACTTGAAAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA2499 [new locus tag: SA_RS14290 ]
  • symbol: GidB
  • description: 16S rRNA methyltransferase GidB
  • length: 239
  • theoretical pI: 6.79958
  • theoretical MW: 27373.2
  • GRAVY: -0.371548

Function[edit source | edit]

  • reaction:
    EC 2.1.1.-?  ExPASy
  • TIGRFAM:
    Genetic information processingProtein synthesistRNA and rRNA base modification16S rRNA (guanine(527)-N(7))-methyltransferase RsmG (TIGR00138; EC 2.1.1.170; HMM-score: 173.8)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMenaquinone and ubiquinone3-demethylubiquinone-9 3-O-methyltransferase (TIGR01983; EC 2.1.1.64; HMM-score: 28.9)
    Genetic information processingProtein fateProtein modification and repairprotein-(glutamine-N5) methyltransferase, release factor-specific (TIGR03534; EC 2.1.1.-; HMM-score: 22.2)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersHeme, porphyrin, and cobalaminprecorrin-6Y C5,15-methyltransferase (decarboxylating), CbiT subunit (TIGR02469; EC 2.1.1.132; HMM-score: 20.6)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersBiotinmalonyl-acyl carrier protein O-methyltransferase BioC (TIGR02072; EC 2.1.1.-; HMM-score: 20)
    Genetic information processingProtein fateProtein modification and repairmethyltransferase, HemK family (TIGR00536; HMM-score: 17.5)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersChlorophyll and bacteriochlorphyllC-20 methyltransferase BchU (TIGR02716; EC 2.1.1.-; HMM-score: 16)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMenaquinone and ubiquinoneubiquinone/menaquinone biosynthesis methyltransferase (TIGR01934; EC 2.1.1.-; HMM-score: 14)
  • TheSEED:  
    Cell Division Subsystem including YidCD 16S rRNA (guanine(527)-N(7))-methyltransferase (EC 2.1.1.170) 
  • PFAM:
    NADP_Rossmann (CL0063) GidB; rRNA small subunit methyltransferase G (PF02527; HMM-score: 195.9)
    Methyltransf_31; Methyltransferase domain (PF13847; HMM-score: 33.1)
    Methyltransf_25; Methyltransferase domain (PF13649; HMM-score: 24.8)
    MTS; Methyltransferase small domain (PF05175; HMM-score: 17.7)
    Methyltransf_32; Methyltransferase domain (PF13679; HMM-score: 16.3)
    Methyltransf_12; Methyltransferase domain (PF08242; HMM-score: 15.9)
    TehB; Tellurite resistance protein TehB (PF03848; HMM-score: 11.4)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.095
    • Ymax_pos: 26
    • Cmax: 0.104
    • Cmax_pos: 26
    • Smax: 0.103
    • Smax_pos: 7
    • Smean: 0.082
    • D: 0.09
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MTVEWLAEQLKEHNIELTETQKQQFQTYYRLLVEWNEKMNLTSITDEHDVYLKHFYDSIAPSFYFDFNQPISICDVGAGAGFPSIPLKIMFPQLKVTIVDSLNKRIQFLNHLASELQLQDVSFIHDRAETFGKGVYRESYDVVTARAVARLSVLSELCLPLIKKGGQFVALKSSKGEEELEEAKFAISVLGGNVTETHTFKLPEDAGERQMFIIDKKRQTPKKYPRKPGTPNKTPLLEK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]