From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL0191 [new locus tag: SACOL_RS00975 ]
  • pan locus tag?: SAUPAN001063000
  • symbol: SACOL0191
  • pan gene symbol?:
  • synonym:
  • product: M23/M37 peptidase domain-containing protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL0191 [new locus tag: SACOL_RS00975 ]
  • symbol: SACOL0191
  • product: M23/M37 peptidase domain-containing protein
  • replicon: chromosome
  • strand: +
  • coordinates: 224443..225021
  • length: 579
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    ATGACAAAGCGACCAAAACGTATTTTGGCAACAATTATCATTTTTCTTTCACTATTATTT
    ACGATTATTTATATAGATGACATTCAAAAATGGTTTAACCAATATACCGATAAATTGACA
    CAAAATCATAAAGGACAAGGACACTCAAAATGGGAAGACTTTTTTAGAGGGAGTCGGATT
    ACTGAGACTTTTGGTAAATATCAACATTCACCATTTGATGGTAAGCATTATGGCATTGAT
    TTTGCATTGCCAAAAGGTACACCAATTAAAGCGCCGACGAATGGTAAAGTAACACGTATC
    TTTAATAATGAATTGGGCGGCAAGGTATTACAGATTGCCGAAGACAATGGAGAATATCAC
    CAGTGGTATCTACACTTAGACAAATATAATGTCAAAGTAGGTGATCGAGTCAAAGCAGGT
    GATATTATTGCATATTCAGGCAATACAGGTATACAAACGACAGGCGCACATTTACATTTT
    CAAAGAATGAAGGGTGGCGTAGGTAATGCATATGCAGAAGATCCAAAACCGTTTATCGAT
    CAGTTACCTGATGGGGAACGTAGCCTATATGATTTGTAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    579

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL0191 [new locus tag: SACOL_RS00975 ]
  • symbol: SACOL0191
  • description: M23/M37 peptidase domain-containing protein
  • length: 192
  • theoretical pI: 9.5492
  • theoretical MW: 21935.7
  • GRAVY: -0.586458

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    PTS system, beta-glucoside-specific IIABC component (TIGR01995; EC 2.7.1.69; HMM-score: 9.8)
    Genetic information processingTranscriptionDNA-dependent RNA polymeraseDNA-directed RNA polymerase, beta' subunit (TIGR02386; EC 2.7.7.6; HMM-score: 9.1)
  • TheSEED:  
    M23/M37 peptidase domain protein 
  • PFAM:
    Hybrid (CL0105) Peptidase_M23; Peptidase family M23 (PF01551; HMM-score: 94.2)
    Biotin_lipoyl_2; Biotin-lipoyl like (PF13533; HMM-score: 25.5)
    Apocytochr_F_C; Apocytochrome F, C-terminal (PF01333; HMM-score: 16.2)
    Biotin_lipoyl; Biotin-requiring enzyme (PF00364; HMM-score: 15.8)
    RnfC_N; RnfC Barrel sandwich hybrid domain (PF13375; HMM-score: 14.6)
    no clan definedHPIH; N-terminal domain with HPIH motif (PF13323; HMM-score: 14.5)
    Hybrid (CL0105) PTS_EIIA_1; phosphoenolpyruvate-dependent sugar phosphotransferase system, EIIA 1 (PF00358; HMM-score: 12.1)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Extracellular
    • Cytoplasmic Score: 0.01
    • Cytoplasmic Membrane Score: 0.09
    • Cellwall Score: 0.18
    • Extracellular Score: 9.72
    • Internal Helix: 1
  • LocateP: N-terminally anchored (No CS)
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular Possibility: 0.17
    • Signal Peptide Possibility: -0.5
    • N-terminally Anchored Score: 2
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.224
    • Ymax_pos: 11
    • Cmax: 0.127
    • Cmax_pos: 26
    • Smax: 0.647
    • Smax_pos: 2
    • Smean: 0.502
    • D: 0.332
  • predicted transmembrane helices (TMHMM): 1

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MTKRPKRILATIIIFLSLLFTIIYIDDIQKWFNQYTDKLTQNHKGQGHSKWEDFFRGSRITETFGKYQHSPFDGKHYGIDFALPKGTPIKAPTNGKVTRIFNNELGGKVLQIAEDNGEYHQWYLHLDKYNVKVGDRVKAGDIIAYSGNTGIQTTGAHLHFQRMKGGVGNAYAEDPKPFIDQLPDGERSLYDL

Experimental data[edit source | edit]

  • experimental localization: Signal peptide containing [1] [2]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS ONE: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int. J. Med. Microbiol.: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]