From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL0314 [new locus tag: SACOL_RS01585 ]
  • pan locus tag?: SAUPAN001241000
  • symbol: SACOL0314
  • pan gene symbol?: nanR
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL0314 [new locus tag: SACOL_RS01585 ]
  • symbol: SACOL0314
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 349294..350094
  • length: 801
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    ATGAAATTTGAGAATCGTGTTCAACGTTATCAACATTTATTTACAAAAACTGATAAACGC
    ATCGTCAATTATATAAGACAAAATGGTTATAGCGATGCCTTTTCAACGATTAACTCCTTA
    GCCCATGCGATTGGTACATCACCAGCAACGATGACACGCTTTAGTCATAAGCTGGATTAT
    GAGAATTTCCAAGATTTAAAATTTAATATTCAACAAGAAATGACAGAGACAGTTATTGAA
    AATAGCCCAATTATTCAAAGAATTCATAAATATCATCAACAAATCATTCAACAAACTGGT
    GAATTTATTGATAACGACATTATCCAAACCTTTATCGACAAACTTCAATCAAGTCGACAT
    ATACTCTTTGCTGGACTAGGTAGCTCTGGTTTATCAGCGACTGAATTTTATTATCGTATG
    ATTCGTATGGGGCTAAAAGGTAATGTTACTACCGATTCACATTTAATGAAAATATCGGCA
    TCCCTACTATCTCATTCGGATATGTTTATTGCTATGTCAAATAGTGGTAATACTTCGGAA
    TTAATTTCTGCAGCGGAAGTCGCCAAATCTCATGGTGCATATGTCGTTGCCATCACAAAT
    TTTGAAGGTAGTAAACTTACAGATTGTGCAGATTTAGTACTTTTAACAACGGATCAATCG
    CGTAATACCGACCATCAATTTATCAACACACAAATTGCGACACTCTTTTTAATCGATATC
    GTGAGTTATCATTTATTAGAAAATACGAATCTGAGTCAAACTTATCAACATACTAAATCT
    ATTATCCTAGACAACAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    801

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL0314 [new locus tag: SACOL_RS01585 ]
  • symbol: SACOL0314
  • description: hypothetical protein
  • length: 266
  • theoretical pI: 6.97071
  • theoretical MW: 30258
  • GRAVY: -0.282707

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    6-phospho 3-hexuloisomerase (TIGR03127; EC 5.3.-.-; HMM-score: 73.6)
    Cell structureCell envelopeBiosynthesis and degradation of murein sacculus and peptidoglycanglutamine-fructose-6-phosphate transaminase (isomerizing) (TIGR01135; EC 2.6.1.16; HMM-score: 38.1)
    MetabolismCentral intermediary metabolismAmino sugarsglutamine-fructose-6-phosphate transaminase (isomerizing) (TIGR01135; EC 2.6.1.16; HMM-score: 38.1)
    bifunctional phosphoglucose/phosphomannose isomerase (TIGR02128; EC 5.3.1.9; HMM-score: 33.7)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesphosphoheptose isomerase (TIGR00441; EC 5.3.1.28; HMM-score: 27.7)
    MetabolismEnergy metabolismSugarssugar isomerase, KpsF/GutQ family (TIGR00393; HMM-score: 23.9)
    Cell structureCell envelopeBiosynthesis and degradation of murein sacculus and peptidoglycanN-acetylmuramic acid 6-phosphate etherase (TIGR00274; EC 4.2.1.126; HMM-score: 21.1)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairDNA topoisomerase IV, B subunit (TIGR01058; EC 5.99.1.-; HMM-score: 14.3)
  • TheSEED:  
    Cell Wall and CapsuleCapsular and extracellular polysacchridesSialic Acid Metabolism Sialic acid utilization regulator, RpiR family 
  • PFAM:
    SIS (CL0067) SIS; SIS domain (PF01380; HMM-score: 57.8)
    HTH (CL0123) HTH_6; Helix-turn-helix domain, rpiR family (PF01418; HMM-score: 50.5)
    SIS (CL0067) SIS_2; SIS domain (PF13580; HMM-score: 42.8)
    HTH (CL0123) Dimerisation2; Dimerisation domain (PF16864; HMM-score: 19)
    HTH_24; Winged helix-turn-helix DNA-binding (PF13412; HMM-score: 15.3)
    no clan definedTyrRSs_C; Tyrosyl-tRNA synthetase C-terminal domain (PF16714; HMM-score: 14.1)
    DUF1643; Protein of unknown function (DUF1643) (PF07799; HMM-score: 13)
    HTH (CL0123) MarR; MarR family (PF01047; HMM-score: 12.6)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.161
    • Ymax_pos: 44
    • Cmax: 0.171
    • Cmax_pos: 44
    • Smax: 0.322
    • Smax_pos: 8
    • Smean: 0.157
    • D: 0.159
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MKFENRVQRYQHLFTKTDKRIVNYIRQNGYSDAFSTINSLAHAIGTSPATMTRFSHKLDYENFQDLKFNIQQEMTETVIENSPIIQRIHKYHQQIIQQTGEFIDNDIIQTFIDKLQSSRHILFAGLGSSGLSATEFYYRMIRMGLKGNVTTDSHLMKISASLLSHSDMFIAMSNSGNTSELISAAEVAKSHGAYVVAITNFEGSKLTDCADLVLLTTDQSRNTDHQFINTQIATLFLIDIVSYHLLENTNLSQTYQHTKSIILDNK

Experimental data[edit source | edit]

  • experimentally validated: PeptideAtlas
    experimental localization: Cytoplasmic [1] [2] [3]
    quantitative data / protein copy number per cell: 27 [4]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SACOL0314 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator: SACOL0314 (NanR*)
    NanR* (TF) important in N-acetylglucosamine utilization, Sialic acid utilizationRegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS ONE: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J. Proteome Res.: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)
  3. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int. J. Med. Microbiol.: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)
  4. Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
    Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
    Sci Rep: 2016, 6;28172
    [PubMed:27344979] [WorldCat.org] [DOI] (I e)

Relevant publications[edit source | edit]