From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL0502 [new locus tag: SACOL_RS02535 ]
  • pan locus tag?: SAUPAN002174000
  • symbol: SACOL0502
  • pan gene symbol?: mccA
  • synonym:
  • product: cysteine synthase/cystathionine beta-synthase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL0502 [new locus tag: SACOL_RS02535 ]
  • symbol: SACOL0502
  • product: cysteine synthase/cystathionine beta-synthase
  • replicon: chromosome
  • strand: +
  • coordinates: 502702..503616
  • length: 915
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    ATGATTACTTATGATTTAATTGGCAATACACCATTAGTACTGTTAGAACATTATAGTGAT
    GATAAAGTTAAAATTTATGCCAAGCTTGAACAATGGAATCCTGGAGGCAGTGTTAAAGAC
    AGACTCGGGAAATATTTAGTAGAGAAGGCAATTCAAGAAGGGCGTGTGCGTGCAGGTCAA
    ACTATTGTTGAAGCGACTGCTGGTAATACAGGCATAGGGTTAGCTATTGCAGCGAATAGA
    CATCATTTGAAATGTAAGATCTTTGCGCCGTATGGTTTTTCAGAAGAAAAGATTAATATT
    ATGATAGCGCTTGGTGCAGAAGTTTCAAGGACGAGTCAGTCTGAAGGTATGCATGGGGCA
    CAATTAGCTGCACGTTCCTATGCTGAAAAATATGGTGCCGTTTATATGAATCAATTTGAA
    TCCGAACATAATCCGGATACATATTTTCATACATTGGGACCCGAATTGACTTCAGCATTA
    CAGCAAATTGATTATTTTGTGGCTGGTATTGGCTCTGGCGGTACATTTACAGGTACCGCA
    CGTTATTTAAAGCAACATCACGTGCAATGTTATGCCGTTGAGCCAGAAGGGTCCGTGTTA
    AATGGAGGGCCAGCTCATGCACATGACACTGAAGGTATCGGTTCTGAGAAATGGCCGATA
    TTTTTAGAGAGACGTCTTGTAGATGGGATATTTACGATTAAAGATCAAGATGCCTTTCGA
    AATGTCAAAAGTTTGGCTATAAATGAAGGGTTGTTAGTAGGCAGTTCTTCAGGTGCAGCA
    TTACAAGGTGCATTGAATTTAAAAGCGCAATTATCTGAAGGTACGATTGTTGTCGTATTT
    CCAGATGGTAGTGATCGATATATGTCTAAGCAAATATTTAATTATGAGGAGAATAATAAT
    GAACAAGAAAACTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    915

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL0502 [new locus tag: SACOL_RS02535 ]
  • symbol: SACOL0502
  • description: cysteine synthase/cystathionine beta-synthase
  • length: 304
  • theoretical pI: 5.79025
  • theoretical MW: 33261.1
  • GRAVY: -0.3125

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    MetabolismAmino acid biosynthesisSerine familycysteine synthase (TIGR01136; EC 2.5.1.47; HMM-score: 271.8)
    MetabolismAmino acid biosynthesisSerine familycysteine synthase A (TIGR01139; EC 2.5.1.47; HMM-score: 261.7)
    MetabolismAmino acid biosynthesisSerine familycystathionine beta-synthase (TIGR01137; EC 4.2.1.22; HMM-score: 258.4)
    MetabolismAmino acid biosynthesisSerine familycysteine synthase B (TIGR01138; EC 2.5.1.47; HMM-score: 218)
    Cellular processesCellular processesBiosynthesis of natural products2,3-diaminopropionate biosynthesis protein SbnA (TIGR03945; HMM-score: 203.3)
    MetabolismAmino acid biosynthesisPyruvate familythreonine ammonia-lyase (TIGR01127; EC 4.3.1.19; HMM-score: 65.1)
    MetabolismAmino acid biosynthesisPyruvate familythreonine dehydratase (TIGR02079; EC 4.3.1.19; HMM-score: 46.5)
    MetabolismAmino acid biosynthesisPyruvate familythreonine ammonia-lyase, biosynthetic (TIGR01124; EC 4.3.1.19; HMM-score: 42.1)
    MetabolismAmino acid biosynthesisAspartate familythreonine synthase (TIGR00260; EC 4.2.3.1; HMM-score: 39.6)
    MetabolismAmino acid biosynthesisAromatic amino acid familytryptophan synthase, beta subunit (TIGR00263; EC 4.2.1.20; HMM-score: 35.8)
    ectoine utilization protein EutB (TIGR02991; HMM-score: 30.2)
    Unknown functionEnzymes of unknown specificitypyridoxal-phosphate dependent TrpB-like enzyme (TIGR01415; HMM-score: 23.1)
    diaminopropionate ammonia-lyase (TIGR03528; EC 4.3.1.15; HMM-score: 22.4)
    MetabolismEnergy metabolismOtherdiaminopropionate ammonia-lyase family (TIGR01747; EC 4.3.1.15; HMM-score: 19.3)
    MetabolismEnergy metabolismAmino acids and aminesD-serine ammonia-lyase (TIGR02035; EC 4.3.1.18; HMM-score: 15.8)
    MetabolismFatty acid and phospholipid metabolismBiosynthesisbeta-hydroxyacyl-(acyl-carrier-protein) dehydratase FabZ (TIGR01750; EC 4.2.1.-; HMM-score: 12)
  • TheSEED:  
    Amino Acids and DerivativesAlanine, serine, and glycineGlycine and Serine Utilization Cystathionine beta-synthase (EC 4.2.1.22) 
    Lysine, threonine, methionine, and cysteineCysteine Biosynthesis Cystathionine beta-synthase (EC 4.2.1.22) 
    Lysine, threonine, methionine, and cysteineMethionine Biosynthesis Cystathionine beta-synthase (EC 4.2.1.22) 
    Lysine, threonine, methionine, and cysteineMethionine Degradation Cystathionine beta-synthase (EC 4.2.1.22) 
  • PFAM:
    no clan definedPALP; Pyridoxal-phosphate dependent enzyme (PF00291; HMM-score: 209.7)
    Acyltransferase (CL0228) DUF374; Domain of unknown function (DUF374) (PF04028; HMM-score: 15.2)
    NADP_Rossmann (CL0063) Pyr_redox_2; Pyridine nucleotide-disulphide oxidoreductase (PF07992; HMM-score: 11.7)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SACOL1307hypothetical protein  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.117
    • Ymax_pos: 28
    • Cmax: 0.112
    • Cmax_pos: 28
    • Smax: 0.171
    • Smax_pos: 23
    • Smean: 0.095
    • D: 0.108
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MITYDLIGNTPLVLLEHYSDDKVKIYAKLEQWNPGGSVKDRLGKYLVEKAIQEGRVRAGQTIVEATAGNTGIGLAIAANRHHLKCKIFAPYGFSEEKINIMIALGAEVSRTSQSEGMHGAQLAARSYAEKYGAVYMNQFESEHNPDTYFHTLGPELTSALQQIDYFVAGIGSGGTFTGTARYLKQHHVQCYAVEPEGSVLNGGPAHAHDTEGIGSEKWPIFLERRLVDGIFTIKDQDAFRNVKSLAINEGLLVGSSSGAALQGALNLKAQLSEGTIVVVFPDGSDRYMSKQIFNYEENNNEQEN

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator: SACOL1681 (CymR*)
    CymR* (TF) important in Cysteine metabolism  RegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]