From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL0515 [new locus tag: SACOL_RS02600 ]
  • pan locus tag?: SAUPAN002187000
  • symbol: gltD
  • pan gene symbol?: gltD
  • synonym:
  • product: glutamate synthase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL0515 [new locus tag: SACOL_RS02600 ]
  • symbol: gltD
  • product: glutamate synthase
  • replicon: chromosome
  • strand: +
  • coordinates: 518175..519638
  • length: 1464
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    ATGGGTGAATTTAAAGGATTTATGAAGTATGACAAACAGTACTTAGGTGAATTATCACTG
    GTAGACCGTTTGAAGCATCATAAAGCATATCAACAACGATTTACTAAAGAAGATGCCTCT
    ATCCAAGGTGCACGATGTATGGATTGTGGAACGCCGTTTTGTCAAACCGGACAACAGTAT
    GGTAGGGAAACAATAGGTTGTCCAATTGGAAACTACATTCCTGAATGGAACGACTTAGTG
    TATCATCAAGATTTTAAAACTGCTTATGAACGCTTAAGCGAAACAAATAACTTTCCTGAC
    TTTACAGGGCGTGTATGTCCTGCACCATGCGAAAGTGCTTGTGTGATGAAGATTAATAGA
    GAATCGATTGCGATTAAAGGTATTGAACGCACAATTATTGATGAAGCTTTTGAAAATGGT
    TGGGTAGCGCCGAAAGTTCCGAGTCGCCGTAGAGATGAAAAAGTGGCAATCGTTGGAAGC
    GGTCCAGCAGGATTAGCTGCTGCTGAAGAACTTAATCTACTAGGATATCAAGTAACTATT
    TATGAACGTGCTAGAGAATCAGGCGGTTTATTAATGTATGGTATTCCGAATATGAAACTT
    GATAAAGATGTGGTTCGACGTCGTATTAAGTTAATGGAAGAAGCGGGCATTACTTTCATT
    AATGGTGTTGAAGTCGGCGTTGATATTGATAAAGCAACGTTAGAATCTGAGTATGATGCC
    ATTATATTATGTACTGGTGCACAAAAAGGTAGAGATTTACCTTTAGAAGGACGCATGGGT
    GATGGTATACATTTCGCTATGGATTATTTAACTGAACAAACGCAGTTGTTAAATGGAGAA
    ATTGATGATATAACAATAACTGCAAAAGATAAGAATGTCATTATCATTGGTGCTGGTGAT
    ACAGGGGCAGACTGTGTAGCGACAGCATTAAGAGAAAATTGTAAATCGATTGTTCAATTT
    AATAAATATACGAAATTGCCAGAAGCAATTACATTTACAGAAAATGCATCATGGCCTTTA
    GCAATGCCGGTGTTTAAAATGGACTATGCGCACCAAGAGTACGAAGCTAAGTTTGGTAAG
    GAACCACGTGCATATGGTGTTCAAACAATGCGTTACGATGTTGACGATAAAGGACACATA
    CGTGGTTTGTATACTCAAATTTTAGAGCAAGGCGAAAATGGTATGGTCATGAAAGAAGGA
    CCTGAAAGATTTTGGCCTGCTGACCTTGTATTATTATCAATCGGCTTCGAAGGTACAGAA
    CCAACAGTACCGAATGCTTTTAACATTAAAACGGATAGAAATCGAATCGTGGCGGATGAT
    ACAAACTATCAAACTAATAATGAAAAGGTATTTGCTGCTGGAGATGCTAGACGTGGTCAA
    AGTTTAGTTGTATGGGCAATTAAAGAAGGTAGAGGCGTAGCGAAAGCAGTAGATCAGTAT
    TTAGCTAGTAAAGTTTGTGTATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1464

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL0515 [new locus tag: SACOL_RS02600 ]
  • symbol: GltD
  • description: glutamate synthase
  • length: 487
  • theoretical pI: 5.04058
  • theoretical MW: 54427.6
  • GRAVY: -0.386242

Function[edit source | edit]

  • reaction:
    EC 1.4.1.13?  ExPASy
    Glutamate synthase (NADPH)2 L-glutamate + NADP+ = L-glutamine + 2-oxoglutarate + NADPH
  • TIGRFAM:
    glutamate synthase, NADH/NADPH, small subunit (TIGR01317; EC 1.4.1.-; HMM-score: 612.7)
    glutamate synthase, small subunit (TIGR01318; HMM-score: 284.6)
    MetabolismAmino acid biosynthesisGlutamate familyglutamate synthase (NADPH), homotetrameric (TIGR01316; EC 1.4.1.13; HMM-score: 226.3)
    putative selenate reductase, YgfK subunit (TIGR03315; HMM-score: 161.7)
    mycofactocin system FadH/OYE family oxidoreductase 2 (TIGR03997; EC 1.-.-.-; HMM-score: 58.4)
    dihydrolipoyl dehydrogenase (TIGR01350; EC 1.8.1.4; HMM-score: 46.4)
    MetabolismEnergy metabolismElectron transportthioredoxin-disulfide reductase (TIGR01292; EC 1.8.1.9; HMM-score: 43.9)
    Cellular processesCellular processesDetoxificationCoA-disulfide reductase (TIGR03385; EC 1.8.1.14; HMM-score: 37.4)
    Unknown functionEnzymes of unknown specificityputative bacillithiol system oxidoreductase, YpdA family (TIGR04018; EC 1.8.-.-; HMM-score: 35.7)
    squalene-associated FAD-dependent desaturase (TIGR03467; HMM-score: 30.2)
    Cellular processesCellular processesDetoxificationmercury(II) reductase (TIGR02053; EC 1.16.1.1; HMM-score: 25.8)
    Unknown functionEnzymes of unknown specificityflavoprotein, HI0933 family (TIGR00275; HMM-score: 25.1)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersThiaminethiazole biosynthesis enzyme (TIGR00292; HMM-score: 24.4)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersChlorophyll and bacteriochlorphyllgeranylgeranyl reductase (TIGR02023; EC 1.3.1.-; HMM-score: 23.5)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersChlorophyll and bacteriochlorphyllgeranylgeranyl reductase (TIGR02028; HMM-score: 23.1)
    MetabolismAmino acid biosynthesisAromatic amino acid familyshikimate dehydrogenase (TIGR00507; EC 1.1.1.25; HMM-score: 21.1)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOtherphytoene desaturase (TIGR02734; EC 1.14.99.-; HMM-score: 20.3)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA U-34 5-methylaminomethyl-2-thiouridine biosynthesis protein MnmC, C-terminal domain (TIGR03197; HMM-score: 20)
    MetabolismEnergy metabolismAmino acids and aminessarcosine oxidase, alpha subunit family (TIGR01372; HMM-score: 19.3)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersChlorophyll and bacteriochlorphyllgeranylgeranyl reductase family (TIGR02032; EC 1.3.1.-; HMM-score: 19.2)
    mycofactocin system FadH/OYE family oxidoreductase 1 (TIGR03996; EC 1.-.-.-; HMM-score: 19.2)
    MetabolismAmino acid biosynthesisOtherpyrrolysine biosynthesis protein PylD (TIGR03911; HMM-score: 19)
    thioredoxin and glutathione reductase (TIGR01438; EC 1.6.4.-; HMM-score: 18.2)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOtherC-3',4' desaturase CrtD (TIGR02733; EC 1.3.99.-; HMM-score: 17.2)
    MetabolismEnergy metabolismElectron transportglutathione-disulfide reductase (TIGR01424; EC 1.8.1.7; HMM-score: 17.1)
    MetabolismEnergy metabolismElectron transportflavocytochrome c (TIGR01813; HMM-score: 16.8)
    lycopene cyclase family protein (TIGR01790; HMM-score: 15.5)
    9,9'-di-cis-zeta-carotene desaturase (TIGR02732; EC 1.3.5.6; HMM-score: 15)
    Cellular processesCellular processesDetoxificationalkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 13.2)
    Cellular processesCellular processesAdaptations to atypical conditionsalkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 13.2)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMenaquinone and ubiquinoneubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6 family (TIGR01988; EC 1.14.13.-; HMM-score: 12.7)
    putative alkyl hydroperoxide reductase F subunit (TIGR03143; EC 1.6.4.-; HMM-score: 12.6)
    FAD dependent oxidoreductase TIGR03364 (TIGR03364; HMM-score: 12.1)
    MetabolismCentral intermediary metabolismNitrogen metabolismnitrite reductase [NAD(P)H], large subunit (TIGR02374; EC 1.7.1.4; HMM-score: 12)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersThiamineglycine oxidase ThiO (TIGR02352; EC 1.4.3.19; HMM-score: 11.9)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersHeme, porphyrin, and cobalaminprotoporphyrinogen oxidase (TIGR00562; EC 1.3.3.4; HMM-score: 11.7)
  • TheSEED:  
    Amino Acids and DerivativesGlutamine, glutamate, aspartate, asparagine; ammonia assimilationGlutamine, Glutamate, Aspartate and Asparagine Biosynthesis Glutamate synthase [NADPH] small chain (EC 1.4.1.13) 
    Nitrogen MetabolismNitrogen Metabolism - no subcategoryAmmonia assimilation Glutamate synthase [NADPH] small chain (EC 1.4.1.13) 
  • PFAM:
    NADP_Rossmann (CL0063) Pyr_redox_2; Pyridine nucleotide-disulphide oxidoreductase (PF07992; HMM-score: 104)
    4Fe-4S (CL0344) Fer4_20; Dihydroprymidine dehydrogenase domain II, 4Fe-4S cluster (PF14691; HMM-score: 83)
    NADP_Rossmann (CL0063) DAO; FAD dependent oxidoreductase (PF01266; HMM-score: 34.5)
    Pyr_redox; Pyridine nucleotide-disulphide oxidoreductase (PF00070; HMM-score: 32.1)
    NAD_binding_8; NAD(P)-binding Rossmann-like domain (PF13450; HMM-score: 31.7)
    Pyr_redox_3; Pyridine nucleotide-disulphide oxidoreductase (PF13738; HMM-score: 28.9)
    FAD_binding_3; FAD binding domain (PF01494; HMM-score: 26.5)
    HI0933_like; HI0933-like protein (PF03486; HMM-score: 25.3)
    K_oxygenase; L-lysine 6-monooxygenase (NADPH-requiring) (PF13434; HMM-score: 23.3)
    Shikimate_DH; Shikimate / quinate 5-dehydrogenase (PF01488; HMM-score: 23.3)
    Thi4; Thi4 family (PF01946; HMM-score: 23)
    AlaDh_PNT_C; Alanine dehydrogenase/PNT, C-terminal domain (PF01262; HMM-score: 21)
    NAD_binding_7; Putative NAD(P)-binding (PF13241; HMM-score: 20.6)
    2-Hacid_dh_C; D-isomer specific 2-hydroxyacid dehydrogenase, NAD binding domain (PF02826; HMM-score: 20)
    FAD_binding_2; FAD binding domain (PF00890; HMM-score: 19.6)
    FMO-like; Flavin-binding monooxygenase-like (PF00743; HMM-score: 17.9)
    GIDA; Glucose inhibited division protein A (PF01134; HMM-score: 17.3)
    FAD_oxidored; FAD dependent oxidoreductase (PF12831; HMM-score: 17)
    YjeF_N; YjeF-related protein N-terminus (PF03853; HMM-score: 16)
    NAD_binding_9; FAD-NAD(P)-binding (PF13454; HMM-score: 14.6)
    no clan definedPALP; Pyridoxal-phosphate dependent enzyme (PF00291; HMM-score: 13.6)
    NADP_Rossmann (CL0063) IlvN; Acetohydroxy acid isomeroreductase, NADPH-binding domain (PF07991; HMM-score: 13.4)
    NAD_Gly3P_dh_N; NAD-dependent glycerol-3-phosphate dehydrogenase N-terminus (PF01210; HMM-score: 12.2)
    3HCDH_N; 3-hydroxyacyl-CoA dehydrogenase, NAD binding domain (PF02737; HMM-score: 12.1)
    Lycopene_cycl; Lycopene cyclase protein (PF05834; HMM-score: 11.1)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.112
    • Ymax_pos: 62
    • Cmax: 0.112
    • Cmax_pos: 62
    • Smax: 0.154
    • Smax_pos: 24
    • Smean: 0.093
    • D: 0.105
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MGEFKGFMKYDKQYLGELSLVDRLKHHKAYQQRFTKEDASIQGARCMDCGTPFCQTGQQYGRETIGCPIGNYIPEWNDLVYHQDFKTAYERLSETNNFPDFTGRVCPAPCESACVMKINRESIAIKGIERTIIDEAFENGWVAPKVPSRRRDEKVAIVGSGPAGLAAAEELNLLGYQVTIYERARESGGLLMYGIPNMKLDKDVVRRRIKLMEEAGITFINGVEVGVDIDKATLESEYDAIILCTGAQKGRDLPLEGRMGDGIHFAMDYLTEQTQLLNGEIDDITITAKDKNVIIIGAGDTGADCVATALRENCKSIVQFNKYTKLPEAITFTENASWPLAMPVFKMDYAHQEYEAKFGKEPRAYGVQTMRYDVDDKGHIRGLYTQILEQGENGMVMKEGPERFWPADLVLLSIGFEGTEPTVPNAFNIKTDRNRIVADDTNYQTNNEKVFAAGDARRGQSLVVWAIKEGRGVAKAVDQYLASKVCV

Experimental data[edit source | edit]

  • experimentally validated: PeptideAtlas
    experimental localization: Cytoplasmic [1] [2] [3]
    quantitative data / protein copy number per cell: 194 [4]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulators: CodY, GltC
    CodY (TF) important in Amino acid metabolism  RegPrecise    transcription unit transferred from N315 data RegPrecise
    GltC (TF) important in Glutamate metabolism  RegPrecise    transcription unit transferred from N315 data RegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]