From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL0621 [new locus tag: SACOL_RS03210 ]
  • pan locus tag?: SAUPAN002352000
  • symbol: SACOL0621
  • pan gene symbol?: vraA
  • synonym:
  • product: substrate--CoA ligase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL0621 [new locus tag: SACOL_RS03210 ]
  • symbol: SACOL0621
  • product: substrate--CoA ligase
  • replicon: chromosome
  • strand: +
  • coordinates: 654746..656122
  • length: 1377
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    ATGAACGTAATTTTAGAACAGTTGAAAACACATACTCAAAATAAACCTAATGACATAGCA
    TTACATATCGATGATGAAACAATTACATATAGTCAACTAAATGCCCGCATCACTAGCGCA
    GTTGAATCTTTGCAGAAATATTCACTTAACCCTGTCGTTGCTATTAATATGAAATCACCG
    GTGCAAAGTATTATTTGTTATTTAGCTTTGCATCGTTTACATAAAGTGCCTATGATGATG
    GAAGGTAAATGGCAAAGTACTATACATCGTCAATTGATTGAAAAATATGGTATTAAAGAT
    GTAATTGGAGATACAGGTCTCATGCAGAATATAGACTCACCGATGTTTATTGATTCAACG
    CAATTACAGCACTACCCCAATTTATTACATATTGGTTTTACTTCAGGGACAACTGGACTG
    CCAAAAGCATATTATCGTGATGAAGATTCATGGTTGGCTTCTTTTGAAGTTAATGAAATG
    TTGATGTTAAAAAATGAAAATGCAATAGCAGCCCCTGGACCACTATCGCACTCGTTAACA
    TTATATGCGTTATTGTTTGCTTTAAGTTCCGGTCGTACTTTTATAGGACAGACCACTTTT
    CATCCTGAAAAGTTACTTAATCAATGTCATAAAATATCATCATACAAAGTTGCTATGTTT
    CTTGTTCCAACGATGATTAAATCATTATTGTTAGTTTACAACAATGAACATACAATCCAA
    TCATTTTTTAGCAGTGGAGATAAGCTGCATTCTTCTATTTTTAAAAAGATAAAAAATCAA
    GCAAATGACATAAATTTGATTGAATTTTTTGGTACATCGGAAACCAGTTTTATCAGCTAT
    AACTTGAATCAGCAAGCACCAGTTGAATCAGTAGGTGTGCTATTTCCAAATGTGGAATTG
    AAAACAACGAATCACGATCACAATGGTATAGGAACTATTTGTATAAAAAGTAATATGATG
    TTTAGTGGCTATGTAAGTGAACAATGTATAAATAATGATGAATGGTTTGTTACTAATGAT
    AATGGCTATGTAAAAGAGCAGTATTTATATTTAACGGGACGTCAACAGGATATGTTAATT
    ATTGGTGGTCAAAATATATATCCAGCACATGTTGAACGCCTTTTAACGCAATCTTCGAGC
    ATTGATGAAGCAATTATCATCGGTATTCCAAATGAGCGTTTTGGTCAAATAGGCGTATTG
    CTTTATTCTGGTGATGTGACACTTACACATAAAAATGTAAAACAATTTTTAAAAAAGAAA
    GTGAAACGCTATGAAATTCCATCGATGATTCATCATGTAGAAAAGATGTATTACACTGCA
    AGTGGTAAAATTGCTAGAGAAAAAATGATGTCGATGTATTTGAGAGGTGAATTATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1377

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL0621 [new locus tag: SACOL_RS03210 ]
  • symbol: SACOL0621
  • description: substrate--CoA ligase
  • length: 458
  • theoretical pI: 7.53263
  • theoretical MW: 52023.6
  • GRAVY: -0.186245

Function[edit source | edit]

  • reaction:
    EC 6.2.1.-?  ExPASy
  • TIGRFAM:
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMenaquinone and ubiquinoneO-succinylbenzoate-CoA ligase (TIGR01923; EC 6.2.1.26; HMM-score: 171.1)
    acyl-CoA ligase (AMP-forming), exosortase A-associated (TIGR03098; HMM-score: 85.6)
    amino acid adenylation domain (TIGR01733; HMM-score: 78.7)
    cyclohexanecarboxylate-CoA ligase (TIGR03208; EC 6.2.1.-; HMM-score: 75.7)
    dicarboxylate--CoA ligase PimA (TIGR03205; EC 6.2.1.23; HMM-score: 69.1)
    MetabolismTransport and binding proteinsCations and iron carrying compounds(2,3-dihydroxybenzoyl)adenylate synthase (TIGR02275; EC 2.7.7.58; HMM-score: 52.2)
    Cell structureCell envelopeBiosynthesis and degradation of murein sacculus and peptidoglycanD-alanine--poly(phosphoribitol) ligase, subunit 1 (TIGR01734; EC 6.1.1.13; HMM-score: 51.8)
    acetate--CoA ligase (TIGR02188; EC 6.2.1.1; HMM-score: 47.4)
    benzoate-CoA ligase family (TIGR02262; HMM-score: 46.8)
    propionate--CoA ligase (TIGR02316; EC 6.2.1.17; HMM-score: 22.9)
    MetabolismEnergy metabolismOtherphenylacetate-CoA ligase (TIGR02155; EC 6.2.1.30; HMM-score: 19.5)
    4-coumarate--CoA ligase (TIGR02372; EC 6.2.1.12; HMM-score: 17.3)
    L-aminoadipate-semialdehyde dehydrogenase (TIGR03443; EC 1.2.1.31; HMM-score: 15.8)
    MetabolismCentral intermediary metabolismOtheracetoacetate-CoA ligase (TIGR01217; EC 6.2.1.16; HMM-score: 11.3)
  • TheSEED:  
    Cofactors, Vitamins, Prosthetic Groups, PigmentsBiotinBiotin biosynthesis Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) 
  • PFAM:
    ANL (CL0378) AMP-binding; AMP-binding enzyme (PF00501; HMM-score: 118.5)
    AMP-binding_C (CL0531) AMP-binding_C; AMP-binding enzyme C-terminal domain (PF13193; HMM-score: 27.7)
    POZ (CL0033) BTB; BTB/POZ domain (PF00651; HMM-score: 15.2)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.124
    • Ymax_pos: 13
    • Cmax: 0.131
    • Cmax_pos: 55
    • Smax: 0.201
    • Smax_pos: 6
    • Smean: 0.151
    • D: 0.135
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MNVILEQLKTHTQNKPNDIALHIDDETITYSQLNARITSAVESLQKYSLNPVVAINMKSPVQSIICYLALHRLHKVPMMMEGKWQSTIHRQLIEKYGIKDVIGDTGLMQNIDSPMFIDSTQLQHYPNLLHIGFTSGTTGLPKAYYRDEDSWLASFEVNEMLMLKNENAIAAPGPLSHSLTLYALLFALSSGRTFIGQTTFHPEKLLNQCHKISSYKVAMFLVPTMIKSLLLVYNNEHTIQSFFSSGDKLHSSIFKKIKNQANDINLIEFFGTSETSFISYNLNQQAPVESVGVLFPNVELKTTNHDHNGIGTICIKSNMMFSGYVSEQCINNDEWFVTNDNGYVKEQYLYLTGRQQDMLIIGGQNIYPAHVERLLTQSSSIDEAIIIGIPNERFGQIGVLLYSGDVTLTHKNVKQFLKKKVKRYEIPSMIHHVEKMYYTASGKIAREKMMSMYLRGEL

Experimental data[edit source | edit]

  • experimentally validated: PeptideAtlas
    experimental localization: Cytoplasmic [1]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator: BirA
    BirA (TF) important in Biotin biosynthesis  RegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]