From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL0745 [new locus tag: SACOL_RS03825 ]
  • pan locus tag?: SAUPAN002569000
  • symbol: SACOL0745
  • pan gene symbol?:
  • synonym:
  • product: ABC transporter ATP-binding protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL0745 [new locus tag: SACOL_RS03825 ]
  • symbol: SACOL0745
  • product: ABC transporter ATP-binding protein
  • replicon: chromosome
  • strand: +
  • coordinates: 766069..767742
  • length: 1674
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    ATGAAAACACGACTAAAATTTCAAGTAGATAAGGATTTATTGTTAGCTATAGTTGTTGGT
    GTTTGTGGAAGTTTAGTTGCGCTCGCCATGTTTTTCTTAAGTGGTTATATGGTGACACAA
    AGTGCACTTGGTGCGCCACTATACGCTCTGATGATTTTAGTCGTTACAGTAAAATTGTTT
    GGGTTTTTAAGAGCTATTACTCGATACGTAGAGCGCCTTATTTCTCATAAAGCTACATTT
    ACAATGCTACGTGATATTCGGGTACAGTTTTTCGGTAAATTAGTAAATGTCATTCCTAAT
    GTTTACCGTAAACTGAGTTCTAGTGATTTAATTTCACGTATGATTAGTCGTGTTGAGGCA
    TTACAAAATATATATTTACGTGTTTATTATCCACCAGTCGTCATCGGTTTGACAGCGCTA
    GTTACAGTCATAGTTTTGGCGTTCATTTCAATCGGCCATGCGCTATTGATTATGGTTAGC
    ATGTTGTTCACTTTACTCATTGTTCCTTGGTTAAGCTCAAAAAAAGCACGTACTTTAAAG
    AAACATGCAGCTAATGAACAGGCCCGATTTTTAAATCATTTTTATGATTATAAAGCTGGT
    ATGGATGAACTACGTCGATTTAATCAAATTAATCATTATCGAGATAATTTGATGGCTAAA
    TTAAATCATTTTGATAAATTACAACTTAAAGAGCAACGCTTTTTAACGATTTATGATTTT
    ATATTAAATATTATTGCTATGCTTTCGATTTTTGGTAGTTTAGTTCTAGGATTAATTCAA
    ATTAATGCAGGCCAACTAAATATTATTTATATGACGAGTATAGTTTTAATGGTCTTAACT
    TTATTTGAACAAGCTGTACCAATGACAAATGTCGCGTATTATAAAGCGGATACTGACCAA
    GCATTGCACGATATTAATGAAGTGATATCTGTACCTTCTACTAATGGAAAAAAACGTCTT
    AATGATAAGTATGATGCAACGAACATTTATGAAGTTAAGGATGCTAGTTTTAAGTATTGG
    AATCAGCAAACGTATGTGTTGTCGGATATTAATTTTAATGTTAATAGAGGCGAAAAGATT
    GCGATTGTGGGTCCTTCTGGTTCAGGAAAAAGTACATTACTACAAATTATGGCAGGGTTA
    TATCAATTAGATAGTGGCTCTGTTCGTTTCGAAAATATGGATATGTTTGAAATAGATGAC
    AAAGATAAGTTTGAATCGTTAAATGTCTTGCTACAATCTCAACAATTATTTGATGGTACA
    ATACGTCAAAATTTATTTACCGATGAAAAAGATGAAGCGGTGCAAGCAATATTTAAGCAA
    TTAGATTTAGAACATTTGGCACTAGAACGTCAAATTGACTTAGATGGTCATACATTATCT
    GGCGGAGAAATTCAGCGTTTAGCGATTACGAGGATGTTATTAAAAGATACTGCATCAACA
    TGGATTTTAGATGAACCAACAACTGCATTAGATAAACAAAATAGTTTAAAAGTTATGGAT
    TTAATTGAAGCACATGCAGAAACATTAATTGTTGCTACACACGATTTAACTTTATTGTCA
    CGTTTTGAGACCATCATTGTGATGATAAATGGTAAAATAGTTGAAAAGGGAAACTATCAA
    CAATTACTAGCTAATCAAGGTGCTTTATGGAATATGATTCAATATAATGCATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1674

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL0745 [new locus tag: SACOL_RS03825 ]
  • symbol: SACOL0745
  • description: ABC transporter ATP-binding protein
  • length: 557
  • theoretical pI: 8.65473
  • theoretical MW: 63285.6
  • GRAVY: 0.187433

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 320.7)
    thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 219.2)
    Cellular processesCellular processesPathogenesistype I secretion system ATPase (TIGR03375; HMM-score: 201.4)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype I secretion system ATPase (TIGR03375; HMM-score: 201.4)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharideslipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 191.2)
    MetabolismTransport and binding proteinsOtherlipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 191.2)
    Cellular processesCellular processesBiosynthesis of natural productsNHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 171.6)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesNHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 171.6)
    Cellular processesCellular processesBiosynthesis of natural productsNHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 163.7)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesNHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 163.7)
    ABC transporter, permease/ATP-binding protein (TIGR02204; HMM-score: 152.1)
    MetabolismTransport and binding proteinsOtherantigen peptide transporter 2 (TIGR00958; HMM-score: 144.3)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingABC-type bacteriocin transporter (TIGR01193; HMM-score: 141.9)
    Genetic information processingProtein fateProtein modification and repairABC-type bacteriocin transporter (TIGR01193; HMM-score: 141.9)
    MetabolismTransport and binding proteinsOtherABC-type bacteriocin transporter (TIGR01193; HMM-score: 141.9)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype I secretion system ATPase (TIGR01846; HMM-score: 131.6)
    Cellular processesCellular processesToxin production and resistanceputative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 120.9)
    MetabolismTransport and binding proteinsUnknown substrateputative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 120.9)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsglucan exporter ATP-binding protein (TIGR01192; EC 3.6.3.42; HMM-score: 118.4)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype I secretion system ATPase (TIGR01842; HMM-score: 117.1)
    MetabolismTransport and binding proteinsUnknown substrateenergy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 110.4)
    MetabolismTransport and binding proteinsUnknown substrateenergy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 108.6)
    MetabolismTransport and binding proteinsAnionsphosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 106.6)
    Genetic information processingProtein fateProtein and peptide secretion and traffickinglipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 105.2)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingheme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 97.5)
    MetabolismTransport and binding proteinsOtherheme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 97.5)
    ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 95.8)
    Cellular processesCellular processesCell divisioncell division ATP-binding protein FtsE (TIGR02673; HMM-score: 94.7)
    proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 91.3)
    MetabolismTransport and binding proteinsAnionsphosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 90.3)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system (TIGR03864; HMM-score: 89.8)
    MetabolismTransport and binding proteinsOthermulti drug resistance-associated protein (MRP) (TIGR00957; HMM-score: 87.8)
    MetabolismTransport and binding proteinsOtherthiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 86.4)
    MetabolismTransport and binding proteinsAnionssulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 84.9)
    MetabolismTransport and binding proteinsCations and iron carrying compoundsnickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 84.7)
    MetabolismTransport and binding proteinsCations and iron carrying compoundsnickel import ATP-binding protein NikD (TIGR02770; HMM-score: 82.9)
    MetabolismTransport and binding proteinsAnionsmolybdate ABC transporter, ATP-binding protein (TIGR02142; EC 3.6.3.29; HMM-score: 82)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesputative 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TIGR03265; HMM-score: 80.5)
    MetabolismTransport and binding proteinsCations and iron carrying compoundscobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 78)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesurea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 76.2)
    MetabolismTransport and binding proteinsOtherdaunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 76.1)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesLPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 76)
    MetabolismTransport and binding proteinsOtherLPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 76)
    phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 75.6)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminespolyamine ABC transporter, ATP-binding protein (TIGR01187; EC 3.6.3.31; HMM-score: 75.2)
    ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 74.4)
    MetabolismTransport and binding proteinsOtherpigment precursor permease (TIGR00955; HMM-score: 74.1)
    ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 72.5)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesurea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 68.6)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOtherFeS assembly ATPase SufC (TIGR01978; HMM-score: 68.3)
    2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 67.9)
    MetabolismTransport and binding proteinsAnionsnitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 67.8)
    MetabolismTransport and binding proteinsOthernitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 67.8)
    gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 66.2)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesglycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 65.8)
    lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 64.5)
    MetabolismTransport and binding proteinsUnknown substrateanchored repeat-type ABC transporter, ATP-binding subunit (TIGR03771; HMM-score: 62)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminescyclic peptide transporter (TIGR01194; HMM-score: 57.3)
    MetabolismTransport and binding proteinsOthercyclic peptide transporter (TIGR01194; HMM-score: 57.3)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsperoxysomal long chain fatty acyl transporter (TIGR00954; HMM-score: 57)
    MetabolismCentral intermediary metabolismPhosphorus compoundsphosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 56.8)
    MetabolismEnergy metabolismMethanogenesismethyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 53.3)
    D-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 52.4)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminescholine ABC transporter, ATP-binding protein (TIGR03415; HMM-score: 48.6)
    Cellular processesCellular processesOthernodulation ABC transporter NodI (TIGR01288; HMM-score: 47.8)
    MetabolismTransport and binding proteinsOthernodulation ABC transporter NodI (TIGR01288; HMM-score: 47.8)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairexcinuclease ABC subunit A (TIGR00630; EC 3.1.25.-; HMM-score: 42.4)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsD-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 41.8)
    MetabolismTransport and binding proteinsAnionscystic fibrosis transmembrane conductor regulator (CFTR) (TIGR01271; EC 3.6.3.49; HMM-score: 40.5)
    MetabolismTransport and binding proteinsOtherpleiotropic drug resistance family protein (TIGR00956; HMM-score: 35.3)
    type IV secretion/conjugal transfer ATPase, VirB4 family (TIGR00929; HMM-score: 16.4)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairDnaA regulatory inactivator Hda (TIGR03420; HMM-score: 16.2)
    Cellular processesCellular processesChemotaxis and motilityflagellar protein export ATPase FliI (TIGR03496; EC 3.6.3.14; HMM-score: 14.6)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesNucleotide and nucleoside interconversionscytidylate kinase (TIGR00017; EC 2.7.4.14; HMM-score: 14.5)
    MetabolismCentral intermediary metabolismPhosphorus compoundsphosphonate metabolism protein/1,5-bisphosphokinase (PRPP-forming) PhnN (TIGR02322; HMM-score: 14.5)
    Cellular processesCellular processesChemotaxis and motilityflagellar biosynthesis protein FlhF (TIGR03499; HMM-score: 14.4)
  • TheSEED:  
    RespirationElectron accepting reactionsTerminal cytochrome d ubiquinol oxidases Transport ATP-binding protein CydC 
    Electron accepting reactionsTerminal cytochrome oxidases Transport ATP-binding protein CydC 
  • PFAM:
    P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 107.7)
    ABC_membrane (CL0241) ABC_membrane; ABC transporter transmembrane region (PF00664; HMM-score: 54.3)
    P-loop_NTPase (CL0023) AAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 31)
    SMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 26.7)
    AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 21.6)
    AAA_18; AAA domain (PF13238; HMM-score: 19.7)
    RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 18.3)
    AAA_23; AAA domain (PF13476; HMM-score: 17.8)
    no clan definedTmemb_9; TMEM9 (PF05434; HMM-score: 15.5)
    P-loop_NTPase (CL0023) AAA_22; AAA domain (PF13401; HMM-score: 15.4)
    AAA_15; AAA ATPase domain (PF13175; HMM-score: 15.1)
    AAA_14; AAA domain (PF13173; HMM-score: 15.1)
    AAA_16; AAA ATPase domain (PF13191; HMM-score: 14.6)
    Cytidylate_kin; Cytidylate kinase (PF02224; HMM-score: 14.4)
    AAA_24; AAA domain (PF13479; HMM-score: 14.3)
    MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 13.3)
    AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 13.2)
    AAA_33; AAA domain (PF13671; HMM-score: 12.7)
    AAA_28; AAA domain (PF13521; HMM-score: 12.3)
    FtsK_SpoIIIE; FtsK/SpoIIIE family (PF01580; HMM-score: 12.1)
    AAA_30; AAA domain (PF13604; HMM-score: 11.8)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 10
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 6
  • LocateP: Multi-transmembrane
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular Possibility: 0.17
    • Signal Peptide Possibility: -0.5
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.187
    • Ymax_pos: 18
    • Cmax: 0.279
    • Cmax_pos: 45
    • Smax: 0.514
    • Smax_pos: 13
    • Smean: 0.331
    • D: 0.243
  • predicted transmembrane helices (TMHMM): 5

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MKTRLKFQVDKDLLLAIVVGVCGSLVALAMFFLSGYMVTQSALGAPLYALMILVVTVKLFGFLRAITRYVERLISHKATFTMLRDIRVQFFGKLVNVIPNVYRKLSSSDLISRMISRVEALQNIYLRVYYPPVVIGLTALVTVIVLAFISIGHALLIMVSMLFTLLIVPWLSSKKARTLKKHAANEQARFLNHFYDYKAGMDELRRFNQINHYRDNLMAKLNHFDKLQLKEQRFLTIYDFILNIIAMLSIFGSLVLGLIQINAGQLNIIYMTSIVLMVLTLFEQAVPMTNVAYYKADTDQALHDINEVISVPSTNGKKRLNDKYDATNIYEVKDASFKYWNQQTYVLSDINFNVNRGEKIAIVGPSGSGKSTLLQIMAGLYQLDSGSVRFENMDMFEIDDKDKFESLNVLLQSQQLFDGTIRQNLFTDEKDEAVQAIFKQLDLEHLALERQIDLDGHTLSGGEIQRLAITRMLLKDTASTWILDEPTTALDKQNSLKVMDLIEAHAETLIVATHDLTLLSRFETIIVMINGKIVEKGNYQQLLANQGALWNMIQYNA

Experimental data[edit source | edit]

  • experimentally validated: PeptideAtlas
    experimental localization: Integral membrane [1] [2]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS ONE: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int. J. Med. Microbiol.: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]