From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL0959 [new locus tag: SACOL_RS04915 ]
  • pan locus tag?: SAUPAN003058000
  • symbol: SACOL0959
  • pan gene symbol?:
  • synonym:
  • product: Oye family NADH-dependent flavin oxidoreductase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL0959 [new locus tag: SACOL_RS04915 ]
  • symbol: SACOL0959
  • product: Oye family NADH-dependent flavin oxidoreductase
  • replicon: chromosome
  • strand: +
  • coordinates: 959894..961021
  • length: 1128
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    ATGAAAAGTAAATACGAACCATTGTTTGATAAAGTAGAATTACCAAATGGAGTAGAGTTG
    AGAAATCGATTTGTGTTAGCCCCTTTAACACATATTTCTTCAAATGATGATGGTACTATT
    TCAGATGTAGAACTTCCTTATATTGAAAAGCGTTCACAAGATGTTGGTATTACAATTAAT
    GCTGCGAGTAATGTGAGTGATGTCGGAAAAGCATTTCCAGGACAGCCATCAATCGCGCAT
    GACAGTAATATTGAAGGACTAAAACGATTAGCTACAGCAATGAAGAAAAACGGTGCCAAA
    GCACTCGTACAAATACATCATGGCGGTGCACAAGCATTGCCTGAATTAACACCTGATGGA
    GACGTCGTAGCACCAAGTCCAATTTCTTTAAAAAGTTTTGGTCAGAAACAAGAACATAGT
    GCTAGAGAAATGACGAATGAAGAGATTGAACAAGCAATCAAGGATTTTGGTGAAGCAACG
    CGACGTGCAATTGAAGCAGGGTTTGATGGTGTTGAAATACATGGCGCGAATCATTACTTA
    ATTCATCAATTTGTATCACCATACTATAATAGAAGAAATGATGTATGGGCAAATCAATAT
    AAATTCCCGGTCGCTGTGATTGAAGAAGTACTTAAAGCGAAAGAAGCGTATGGCAATAAA
    GACTTTATAGTTGGATACAGATTATCTCCAGAGGAAGCGGAGTCTCCAGGAATCACAATG
    GAAATTACAGAGGAACTCGTTAATAAAATTAGCCATATGCCAATCGACTATATTCATGTT
    TCAATGATGGATACGCATGCAACGACACGTGAAGGTAAATACGCTGGACAAGAAAGACTG
    CCTTTAATTCACAAATGGATAAATGGTCGTATGCCACTTATCGGTATTGGTTCAATTTTC
    ACAGCTGACGAAGCTTTAGATGCAGTTGAAAATGTTGGTGTTGACTTAGTAGCCATTGGT
    AGAGAGCTACTACTGGATTATCAATTTGTTGAAAAAATTAAAGATGGACGGGAAGATGAA
    ATTATTAATTACTTTGATCCAGAGAGAGAAGATAATCATCACTTAACTCCTAATTTATGG
    CATCAATTTAATGAAGGGTTTTATCCATTACCACGTAAAGATAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1128

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL0959 [new locus tag: SACOL_RS04915 ]
  • symbol: SACOL0959
  • description: Oye family NADH-dependent flavin oxidoreductase
  • length: 375
  • theoretical pI: 5.10559
  • theoretical MW: 42109.1
  • GRAVY: -0.4712

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    mycofactocin system FadH/OYE family oxidoreductase 2 (TIGR03997; EC 1.-.-.-; HMM-score: 123.6)
    mycofactocin system FadH/OYE family oxidoreductase 1 (TIGR03996; EC 1.-.-.-; HMM-score: 69.8)
    Unknown functionGeneralputative TIM-barrel protein, nifR3 family (TIGR00737; HMM-score: 21.1)
    dihydroorotate dehydrogenase family protein (TIGR01037; EC 1.3.-.-; HMM-score: 14.7)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesOtherinosine/xanthosine triphosphatase (TIGR00258; HMM-score: 13.7)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersThiaminethiamine-phosphate diphosphorylase (TIGR00693; EC 2.5.1.3; HMM-score: 11.4)
  • TheSEED:  
    Putative NADH-dependent flavin oxidoreductase 
  • PFAM:
    TIM_barrel (CL0036) Oxidored_FMN; NADH:flavin oxidoreductase / NADH oxidase family (PF00724; HMM-score: 242.8)
    TMP-TENI; Thiamine monophosphate synthase (PF02581; HMM-score: 17.1)
    DHO_dh; Dihydroorotate dehydrogenase (PF01180; HMM-score: 16.8)
    AP_endonuc_2; Xylose isomerase-like TIM barrel (PF01261; HMM-score: 15.1)
    Dus; Dihydrouridine synthase (Dus) (PF01207; HMM-score: 13.6)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.124
    • Ymax_pos: 42
    • Cmax: 0.118
    • Cmax_pos: 62
    • Smax: 0.192
    • Smax_pos: 1
    • Smean: 0.122
    • D: 0.123
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MKSKYEPLFDKVELPNGVELRNRFVLAPLTHISSNDDGTISDVELPYIEKRSQDVGITINAASNVSDVGKAFPGQPSIAHDSNIEGLKRLATAMKKNGAKALVQIHHGGAQALPELTPDGDVVAPSPISLKSFGQKQEHSAREMTNEEIEQAIKDFGEATRRAIEAGFDGVEIHGANHYLIHQFVSPYYNRRNDVWANQYKFPVAVIEEVLKAKEAYGNKDFIVGYRLSPEEAESPGITMEITEELVNKISHMPIDYIHVSMMDTHATTREGKYAGQERLPLIHKWINGRMPLIGIGSIFTADEALDAVENVGVDLVAIGRELLLDYQFVEKIKDGREDEIINYFDPEREDNHHLTPNLWHQFNEGFYPLPRKDK

Experimental data[edit source | edit]

  • experimentally validated: PeptideAtlas
    experimental localization: Cytoplasmic [1] [2] [3]
    quantitative data / protein copy number per cell: 845 [4]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: 27.19 h [5]

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]