From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL1186 [new locus tag: SACOL_RS06075 ]
  • pan locus tag?: SAUPAN003440000
  • symbol: SACOL1186
  • pan gene symbol?: psmβ1
  • synonyms: psmβ1, psmB1
  • product: anti protein (phenol soluble modulin)

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL1186 [new locus tag: SACOL_RS06075 ]
  • symbol: SACOL1186
  • product: anti protein (phenol soluble modulin)
  • replicon: chromosome
  • strand: +
  • coordinates: 1192217..1192351
  • length: 135
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    ATGGAAGGTTTATTTAACGCAATTAAAGATACCGTAACTGCAGCAATTAATAATGATGGC
    GCAAAATTAGGCACAAGCATTGTGAGCATCGTTGAAAATGGCGTAGGTTTATTAGGTAAA
    TTATTCGGATTCTAA
    60
    120
    135

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL1186 [new locus tag: SACOL_RS06075 ]
  • symbol: SACOL1186
  • description: anti protein (phenol soluble modulin)
  • length: 44
  • theoretical pI: 4.54462
  • theoretical MW: 4496.17
  • GRAVY: 0.570455

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
  • TheSEED:  
    antibacterial protein 
  • PFAM:
    no clan definedStaph_haemo; Staphylococcus haemolytic protein (PF05480; HMM-score: 83.4)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.113
    • Ymax_pos: 22
    • Cmax: 0.124
    • Cmax_pos: 22
    • Smax: 0.138
    • Smax_pos: 21
    • Smean: 0.09
    • D: 0.104
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MEGLFNAIKDTVTAAINNDGAKLGTSIVSIVENGVGLLGKLFGF

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]

Rong Wang, Kevin R Braughton, Dorothee Kretschmer, Thanh-Huy L Bach, Shu Y Queck, Min Li, Adam D Kennedy, David W Dorward, Seymour J Klebanoff, Andreas Peschel, Frank R DeLeo, Michael Otto
Identification of novel cytolytic peptides as key virulence determinants for community-associated MRSA.
Nat. Med.: 2007, 13(12);1510-4
[PubMed:17994102] [WorldCat.org] [DOI] (I p)
Shu Y Queck, Max Jameson-Lee, Amer E Villaruz, Thanh-Huy L Bach, Burhan A Khan, Daniel E Sturdevant, Stacey M Ricklefs, Min Li, Michael Otto
RNAIII-independent target gene control by the agr quorum-sensing system: insight into the evolution of virulence regulation in Staphylococcus aureus.
Mol. Cell: 2008, 32(1);150-8
[PubMed:18851841] [WorldCat.org] [DOI] (I p)