From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL1526 [new locus tag: SACOL_RS07780 ]
  • pan locus tag?: SAUPAN003950000
  • symbol: SACOL1526
  • pan gene symbol?: ribU
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL1526 [new locus tag: SACOL_RS07780 ]
  • symbol: SACOL1526
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 1564750..1565295
  • length: 546
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    ATGCAACAAAATAAACGTCTTATCACAATAAGTATGTTGAGCGCGATTGCGTTTGTGTTA
    ACTTTTATCAAGTTTCCTATACCATTTTTGCCACCATACTTAACTTTAGATTTTAGTGAT
    GTACCGTCACTACTAGCTACATTTACGTTTGGACCAGTTGCCGGTATCGTAGTTGCACTG
    GTTAAAAATTTATTGAACTACTTATTTAGTATGGGCGATCCAGTTGGACCATTTGCTAAC
    TTTTTAGCAGGCGCAAGTTTCTTATTAACTGCTTACGCCATCTATAAAAATAAACGTTCA
    ACAAAATCTTTGATTACTGGATTAATCATTGCAACAATCGTTATGACTATCGTGTTGAGT
    ATTTTGAACTATTTCGTTCTATTACCTTTGTACGGTATGATATTTAACTTAGCTGATATC
    GCAAATAATCTTAAAGTAATCATTGTTTCAGGAATTATACCATTCAATATTATTAAAGGT
    ATCGTTATTTCTATTGTATTTATTTTACTATATAGAAGGCTTGCGAATTTCTTGAAAAGA
    ATTTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    546

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL1526 [new locus tag: SACOL_RS07780 ]
  • symbol: SACOL1526
  • description: hypothetical protein
  • length: 181
  • theoretical pI: 10.6184
  • theoretical MW: 20024.3
  • GRAVY: 1.10552

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    MetabolismTransport and binding proteinsUnknown substrateECF transporter S component, folate family (TIGR04518; HMM-score: 34.4)
    membrane-bound PQQ-dependent dehydrogenase, glucose/quinate/shikimate family (TIGR03074; EC 1.1.-.-; HMM-score: 9.2)
  • TheSEED:  
    Membrane TransportMembrane Transport - no subcategoryECF class transporters Substrate-specific component RibU of riboflavin ECF transporter 
  • PFAM:
    Gx_transp (CL0315) ECF_trnsprt; ECF transporter, substrate-specific component (PF12822; HMM-score: 96.3)
    ECF-ribofla_trS; ECF-type riboflavin transporter, S component (PF07155; HMM-score: 46.5)
    Thia_YuaJ; Thiamine transporter protein (Thia_YuaJ) (PF09515; HMM-score: 18.9)
    CbiM; Cobalt uptake substrate-specific transmembrane region (PF01891; HMM-score: 17.3)
    no clan definedDUF4118; Domain of unknown function (DUF4118) (PF13493; HMM-score: 15.6)
    Gx_transp (CL0315) Hpre_diP_synt_I; Heptaprenyl diphosphate synthase component I (PF07456; HMM-score: 12.4)
    no clan definedDUF1772; Domain of unknown function (DUF1772) (PF08592; HMM-score: 10)
    Tmemb_14; Transmembrane proteins 14C (PF03647; HMM-score: 8.7)
    DUF5083; Domain of unknown function (DUF5083) (PF16890; HMM-score: 7.4)
    MNHE; Na+/H+ ion antiporter subunit (PF01899; HMM-score: 6.5)
    Peroxisome (CL0484) Pex24p; Integral peroxisomal membrane peroxin (PF06398; HMM-score: 6.1)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 10
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 4
  • LocateP: Multi-transmembrane
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular Possibility: 0.17
    • Signal Peptide Possibility: 0
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.235
    • Ymax_pos: 11
    • Cmax: 0.146
    • Cmax_pos: 60
    • Smax: 0.612
    • Smax_pos: 5
    • Smean: 0.569
    • D: 0.365
  • predicted transmembrane helices (TMHMM): 5

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MQQNKRLITISMLSAIAFVLTFIKFPIPFLPPYLTLDFSDVPSLLATFTFGPVAGIVVALVKNLLNYLFSMGDPVGPFANFLAGASFLLTAYAIYKNKRSTKSLITGLIIATIVMTIVLSILNYFVLLPLYGMIFNLADIANNLKVIIVSGIIPFNIIKGIVISIVFILLYRRLANFLKRI

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]