From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL1841 [new locus tag: SACOL_RS09445 ]
  • pan locus tag?: SAUPAN004508000
  • symbol: SACOL1841
  • pan gene symbol?: rppH
  • synonym:
  • product: hypothetical protein

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SACOL1841 [new locus tag: SACOL_RS09445 ]
  • symbol: SACOL1841
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 1896470..1896949
  • length: 480
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    ATGCGCGTGAAGTTTAGGGATAAAGATAATCGTCAAGTTAATTTGACATTTAAAAAGGAT
    AATGAGATAGCAGATGGCAATCATGTGCTAGCTATTCCAACGTTTAAAAATCAATTGCTT
    TTTACCAAACATAATTTACGGGGGATTGAATTTCCTGGTGGTAAAAGGGAACGCGGGGAA
    AGTAGTGCTGAAGCAGTTACACGTGAATTATATGAAGAAACAGGCGCCAAAGTTAAAAAT
    ATTTATTACATAGCACAATATACCATTGAAACACATGATCAAACTGATTTTGTAAAAGAT
    GTATATTTTATCGAAGTTGAATCATTGGTAAGCAAGAACGATTATTTAGAAACAGCAGGG
    CCAGTGTTGTTTAACTGTATCAATGATATTGAACTCGCACAACGGAGTTTCTTACTGCAA
    GATAGTACCATTTTAAAATGCGTAGAGAGGGTGCAATCACTTGGGTTTTATCAAACGTAA
    60
    120
    180
    240
    300
    360
    420
    480

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SACOL1841 [new locus tag: SACOL_RS09445 ]
  • symbol: SACOL1841
  • description: hypothetical protein
  • length: 159
  • theoretical pI: 5.74715
  • theoretical MW: 18392.6
  • GRAVY: -0.480503

Function[edit | edit source]

  • TIGRFAM:
    Genetic information processing DNA metabolism DNA replication, recombination, and repair nucleoside triphosphatase YtkD (TIGR02705; EC 3.6.1.-; HMM-score: 228.3)
    and 1 more
    Genetic information processing DNA metabolism DNA replication, recombination, and repair mutator mutT protein (TIGR00586; EC 3.6.1.-; HMM-score: 31.8)
  • TheSEED  :
    • Low G+C gram positive nudix hydrolase YtkD (EC 3.6.-.-)
    Nucleosides and Nucleotides Detoxification Nudix proteins (nucleoside triphosphate hydrolases)  Low G+C gram positive nudix hydrolase YtkD (EC 3.6.-.-)
  • PFAM:
    NUDIX (CL0261) NUDIX; NUDIX domain (PF00293; HMM-score: 40.4)
    and 2 more
    no clan defined DUF1064; Protein of unknown function (DUF1064) (PF06356; HMM-score: 14.5)
    RepB_primase; RepB DNA-primase from phage plasmid (PF16793; HMM-score: 12.1)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.00507
    • TAT(Tat/SPI): 0.000255
    • LIPO(Sec/SPII): 0.000552
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MRVKFRDKDNRQVNLTFKKDNEIADGNHVLAIPTFKNQLLFTKHNLRGIEFPGGKRERGESSAEAVTRELYEETGAKVKNIYYIAQYTIETHDQTDFVKDVYFIEVESLVSKNDYLETAGPVLFNCINDIELAQRSFLLQDSTILKCVERVQSLGFYQT

Experimental data[edit | edit source]

  • experimentally validated: PeptideAtlas
  • protein localization: Cytoplasmic [1] [2] [3]
  • quantitative data / protein copy number per cell:
  • interaction partners:

Expression & Regulation[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS One: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J Proteome Res: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)
  3. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int J Med Microbiol: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]