From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL1841 [new locus tag: SACOL_RS09445 ]
  • pan locus tag?: SAUPAN004508000
  • symbol: SACOL1841
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL1841 [new locus tag: SACOL_RS09445 ]
  • symbol: SACOL1841
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 1896470..1896949
  • length: 480
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    ATGCGCGTGAAGTTTAGGGATAAAGATAATCGTCAAGTTAATTTGACATTTAAAAAGGAT
    AATGAGATAGCAGATGGCAATCATGTGCTAGCTATTCCAACGTTTAAAAATCAATTGCTT
    TTTACCAAACATAATTTACGGGGGATTGAATTTCCTGGTGGTAAAAGGGAACGCGGGGAA
    AGTAGTGCTGAAGCAGTTACACGTGAATTATATGAAGAAACAGGCGCCAAAGTTAAAAAT
    ATTTATTACATAGCACAATATACCATTGAAACACATGATCAAACTGATTTTGTAAAAGAT
    GTATATTTTATCGAAGTTGAATCATTGGTAAGCAAGAACGATTATTTAGAAACAGCAGGG
    CCAGTGTTGTTTAACTGTATCAATGATATTGAACTCGCACAACGGAGTTTCTTACTGCAA
    GATAGTACCATTTTAAAATGCGTAGAGAGGGTGCAATCACTTGGGTTTTATCAAACGTAA
    60
    120
    180
    240
    300
    360
    420
    480

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL1841 [new locus tag: SACOL_RS09445 ]
  • symbol: SACOL1841
  • description: hypothetical protein
  • length: 159
  • theoretical pI: 5.74715
  • theoretical MW: 18392.6
  • GRAVY: -0.480503

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Genetic information processingDNA metabolismDNA replication, recombination, and repairnucleoside triphosphatase YtkD (TIGR02705; EC 3.6.1.-; HMM-score: 228.3)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairmutator mutT protein (TIGR00586; EC 3.6.1.-; HMM-score: 31.8)
  • TheSEED:  
    Nucleosides and NucleotidesDetoxificationNudix proteins (nucleoside triphosphate hydrolases) Low G+C gram positive nudix hydrolase YtkD (EC 3.6.-.-) 
  • PFAM:
    NUDIX (CL0261) NUDIX; NUDIX domain (PF00293; HMM-score: 40.4)
    no clan definedDUF1064; Protein of unknown function (DUF1064) (PF06356; HMM-score: 14.5)
    RepB_primase; RepB DNA-primase from phage plasmid (PF16793; HMM-score: 12.1)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.139
    • Ymax_pos: 12
    • Cmax: 0.109
    • Cmax_pos: 49
    • Smax: 0.234
    • Smax_pos: 4
    • Smean: 0.189
    • D: 0.158
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MRVKFRDKDNRQVNLTFKKDNEIADGNHVLAIPTFKNQLLFTKHNLRGIEFPGGKRERGESSAEAVTRELYEETGAKVKNIYYIAQYTIETHDQTDFVKDVYFIEVESLVSKNDYLETAGPVLFNCINDIELAQRSFLLQDSTILKCVERVQSLGFYQT

Experimental data[edit source | edit]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]