From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL1846 [new locus tag: SACOL_RS09470 ]
  • pan locus tag?: SAUPAN004514000
  • symbol: SACOL1846
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL1846 [new locus tag: SACOL_RS09470 ]
  • symbol: SACOL1846
  • product: hypothetical protein
  • replicon: chromosome
  • strand: +
  • coordinates: 1900664..1901314
  • length: 651
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    ATGAAAATAACATATAAATATAGAGGAGATTTACCTTTGAATACAGAGAACAACAAGAAT
    CAAAACCAATCTGTTAAAAATTCTGAAAGACGCGGCATGTTAAAAGGATGCGGCGGTTGC
    CTTATTTCTTTTATTTTATTAATAATCTTATTATCAGCCTGTTCAATGATGTTTAGTAAT
    AATGACAATTCCACTAATAATCAATCATCAAAAACGCAATTAACTCAAAAAGATGAAAAT
    AAAAATGAAGATAAGCCTGAGGAAAAATCAGAAACAGCAACAGATGAGGATTTACAATCA
    ACCGAAGAAGTACCTGCAAATGAAAATACTGAAAATAATCAACATGAAATTGATGAAATA
    ACAACAAAAGATCAATCAGACGATGATATTAACACACCAAACGTTGCAGAAGATAAATCA
    CAAGACGACTTGAAAGATGATTTAAAAGAAAAGCAACAATCAAGTAACCATCATCAATCC
    ACGCAACCTAAGACCTCACCATCAACTGAAACAAACACGCAACAATCATTTGCTAATTGT
    AAGCAACTTAGACAAGTATATCCGAATGGTGTCACTGCCGATCATCCAGCATATCGACCA
    CATTTAGATAGAGATAAAGATAAACGTGCATGTGAACCTGATAAATATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    651

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL1846 [new locus tag: SACOL_RS09470 ]
  • symbol: SACOL1846
  • description: hypothetical protein
  • length: 216
  • theoretical pI: 4.66027
  • theoretical MW: 24543.5
  • GRAVY: -1.3963

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Cellular processesCellular processesPathogenesisputative immunoglobulin-blocking virulence protein (TIGR04526; HMM-score: 16.2)
    Cellular processesCellular processesPathogenesistype III secretion protein, HrcV family (TIGR01399; HMM-score: 14.6)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype III secretion protein, HrcV family (TIGR01399; HMM-score: 14.6)
    TIGR03943 family protein (TIGR03943; HMM-score: 13.2)
    Cellular processesCellular processesCell divisioncell division protein FtsL (TIGR02209; HMM-score: 13)
    Cellular processesCellular processesCell divisioncell division protein ZipA (TIGR02205; HMM-score: 10.4)
    MetabolismTransport and binding proteinsCations and iron carrying compoundspotassium uptake protein, Trk family (TIGR00934; HMM-score: 5.8)
    MetabolismTransport and binding proteinsNucleosides, purines and pyrimidinesnucleoside Transporter (TIGR00939; HMM-score: 5.6)
    Cellular processesCellular processesSporulation and germinationstage III sporulation protein AF (TIGR02896; HMM-score: 5.4)
    MetabolismTransport and binding proteinsOtherpleiotropic drug resistance family protein (TIGR00956; HMM-score: 4.7)
  • TheSEED:  
    Hypothetical protein SAV1799 
  • PFAM:
    no clan definedExcalibur; Excalibur calcium-binding domain (PF05901; HMM-score: 46.5)
    TMEM51; Transmembrane protein 51 (PF15345; HMM-score: 16.1)
    Piezo_RRas_bdg; Piezo non-specific cation channel, R-Ras-binding domain (PF12166; HMM-score: 16)
    FAM176; FAM176 family (PF14851; HMM-score: 15.7)
    CRA; Circumsporozoite-related antigen (CRA) (PF06589; HMM-score: 15.6)
    DUF1510; Protein of unknown function (DUF1510) (PF07423; HMM-score: 11.6)
    DUF4775; Domain of unknown function (DUF4775) (PF16001; HMM-score: 11.3)
    Viral_ssRNA_CP (CL0055) TT_ORF1; TT viral orf 1 (PF02956; HMM-score: 9.9)
    O-anti_assembly (CL0499) O-antigen_lig; O-antigen ligase like membrane protein (PF13425; HMM-score: 9.5)
    DMT (CL0184) Zip; ZIP Zinc transporter (PF02535; HMM-score: 9.1)
    AhpD-like (CL0423) PA26; PA26 p53-induced protein (sestrin) (PF04636; HMM-score: 8.9)
    no clan definedDUF4692; Domain of unknown function (DUF4692) (PF15763; HMM-score: 8.9)
    EphA2_TM; Ephrin type-A receptor 2 transmembrane domain (PF14575; HMM-score: 8.3)
    GPCR_A (CL0192) SID-1_RNA_chan; dsRNA-gated channel SID-1 (PF13965; HMM-score: 8.2)
    no clan definedSAPS; SIT4 phosphatase-associated protein (PF04499; HMM-score: 7.9)
    SLC12; Solute carrier family 12 (PF03522; HMM-score: 7.9)
    SARAF; SOCE-associated regulatory factor of calcium homoeostasis (PF06682; HMM-score: 7.6)
    P-loop_NTPase (CL0023) Hydin_ADK; Hydin Adenylate kinase-like domain (PF17213; HMM-score: 7.2)
    no clan definedG0-G1_switch_2; G0/G1 switch protein 2 (PF15103; HMM-score: 6.8)
    Golgi_traff (CL0456) Hid1; High-temperature-induced dauer-formation protein (PF12722; HMM-score: 6.1)
    no clan definedMacoilin; Macoilin family (PF09726; HMM-score: 5.9)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helix: 1
  • LocateP: Lipid anchored
    • Prediction by SwissProt Classification: Extracellular
    • Pathway Prediction: Sec-(SPII)
    • Intracellular Possibility: 0.17
    • Signal Peptide Possibility: -0.5
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: LLSACSM
  • SignalP: no predicted signal peptide
    • Ymax: 0.298
    • Ymax_pos: 62
    • Cmax: 0.182
    • Cmax_pos: 62
    • Smax: 0.738
    • Smax_pos: 52
    • Smean: 0.299
    • D: 0.298
  • predicted transmembrane helices (TMHMM): 1

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MKITYKYRGDLPLNTENNKNQNQSVKNSERRGMLKGCGGCLISFILLIILLSACSMMFSNNDNSTNNQSSKTQLTQKDENKNEDKPEEKSETATDEDLQSTEEVPANENTENNQHEIDEITTKDQSDDDINTPNVAEDKSQDDLKDDLKEKQQSSNHHQSTQPKTSPSTETNTQQSFANCKQLRQVYPNGVTADHPAYRPHLDRDKDKRACEPDKY

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]