From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL1929 [new locus tag: SACOL_RS10090 ]
  • pan locus tag?: SAUPAN004854000
  • symbol: SACOL1929
  • pan gene symbol?:
  • synonym:
  • product: ABC transporter ATP-binding protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL1929 [new locus tag: SACOL_RS10090 ]
  • symbol: SACOL1929
  • product: ABC transporter ATP-binding protein
  • replicon: chromosome
  • strand: -
  • coordinates: 1993863..1995380
  • length: 1518
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    ATGGGAAGTTCAATTGTTTTAAAGTTACTAAAAGTAACACACTACTATAGGAATAAACAG
    AATAAGAAATGGTATTTACCTTTTGGATATGATGCTGAAGATATCGATTTAAACAATATT
    AGTTTACATATTTATCAAGGAGAAGCATTAGGTATAATTGGTGAACCTGAATCTTCCAAA
    GCGTTGGTAGGTCAATTGTTGGCAGGTGCAATTAAACCTGATAAAGGTAAAGTAGTTTGT
    ACTGAAGATTTGTTCTACGGATATATTGAAGATCAATCGTTAATTCATCAAACTGTTGAA
    GCTTATACAGCGCAGTTAGTTCAACTATTTCCATATGAAATTAATGATCATAAAGCTGAA
    CAGATTATTCAATATGCACATTTAGGTGATTATAAAACGAAGCCGGTTAACCATATTTCG
    AAAGCGGCATACGCTCAATTACTATTAAGTATTGCACGCTCATCAAAATCAAATATTATT
    ATTTTAAATCATGTTATTGACTATTTAACACCACAATTTATGGAACGTGCGATTGAATTA
    ACAAATGATTATATTGAAAATAATTTAACGATTGTGTCAATTGGTGATGATATTGATAAA
    ATTTCACAAGTGAGTAACTACATAGCTTGGTTTTCACATGGTCAATTAAGAATGGAAGGG
    TCACTTAAACAAGTTATTCCATCTTTTAAAGAACATGAACGTGATCGATTAAGTCTAAAC
    TCAAAAGAAGAAATTGAAAACTTTGATTTAGATTGGAAAAAGAATCGTACAAGAATACCA
    GAGATGACCTATAATTTCAAACGTGTTGAGCGCTATAATCATGCAAAACCGCCTAAGTTT
    TTAGTGCGTTTTTGGACTTTAGCCTCAGGTACTATTTTAGGCTTAGCATTGATGATGTTG
    CTCATTTTCAATAATATAGGAATTATTTCGATAACAGATTTTACGAATCGTGCTACGATG
    CAAAATGAAAATAAAGATCCATATGGCGAAAAGTTAGCTTATGGAATTGCTTTTAATGGC
    AGTGTGGATATGCAAGGGGATAAACAAGTCACAATTCCAAAATATAGTGTAGTTACAATT
    ACTGGCGAAAATAGTAAAAATTATCGTGTTACCGCCGATAATAAGACTTACTATGTTAGT
    AAAGATAAATTAGAATATTTTAACCCGGCAGGTTTATATCAAACGCATAGTTTTAAAAAA
    TTAGCACCATATATGAAATCAAATTATAGTAATTACTATGCATACTTTAATAGTCAATTA
    CATAAAAAGCATAGTTCAGTTATAAAAACTTTAGTTCCTGATGATGATAACCGTTTCGTT
    GCATCCGTTACACAACAACCGATACAATTACTTTTCAATGATAATAATCAGTTATACGGT
    TTTGTTTATCCAATTGTAGATAAAAAAGAATTAAAAGATAAGTTTAATATTAACAATAAC
    ATTTGGATTACTAAAGTTGGGAATGGATATTGTATTGCCAATTTGAAAGAAGACAAATGG
    ATTTATATTGAATTGTAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1518

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL1929 [new locus tag: SACOL_RS10090 ]
  • symbol: SACOL1929
  • description: ABC transporter ATP-binding protein
  • length: 505
  • theoretical pI: 8.41277
  • theoretical MW: 58254
  • GRAVY: -0.39604

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    MetabolismTransport and binding proteinsUnknown substrateenergy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 43.2)
    MetabolismTransport and binding proteinsUnknown substrateenergy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 41)
    lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 32.9)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesurea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 30.7)
    MetabolismTransport and binding proteinsOtherdaunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 29.1)
    MetabolismEnergy metabolismMethanogenesismethyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 26)
    MetabolismTransport and binding proteinsCations and iron carrying compoundsnickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 25.5)
    Cellular processesCellular processesPathogenesistype I secretion system ATPase (TIGR03375; HMM-score: 24.1)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype I secretion system ATPase (TIGR03375; HMM-score: 24.1)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharideslipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 23.5)
    MetabolismTransport and binding proteinsOtherlipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 23.5)
    MetabolismTransport and binding proteinsCations and iron carrying compoundscobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 23.2)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesglycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 22.8)
    MetabolismTransport and binding proteinsAnionsphosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 22.7)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype I secretion system ATPase (TIGR01842; HMM-score: 22.3)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype I secretion system ATPase (TIGR01846; HMM-score: 20.7)
    Genetic information processingProtein fateProtein and peptide secretion and traffickinglipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 20.3)
    2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 20.2)
    D-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 19)
    MetabolismTransport and binding proteinsAnionsnitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 18.9)
    MetabolismTransport and binding proteinsOthernitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 18.9)
    ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 18.1)
    Cellular processesCellular processesOthernodulation ABC transporter NodI (TIGR01288; HMM-score: 17.7)
    MetabolismTransport and binding proteinsOthernodulation ABC transporter NodI (TIGR01288; HMM-score: 17.7)
    thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 17.3)
    Cellular processesCellular processesBiosynthesis of natural productsNHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 17.2)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesNHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 17.2)
    MetabolismTransport and binding proteinsOtherthiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 16.6)
    ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 16.1)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesLPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 15.5)
    MetabolismTransport and binding proteinsOtherLPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 15.5)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsD-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 15.2)
    MetabolismTransport and binding proteinsAnionssulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 14.6)
    MetabolismCentral intermediary metabolismPhosphorus compoundsphosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 14.5)
    MetabolismTransport and binding proteinsAnionsphosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 14.3)
    Cellular processesCellular processesBiosynthesis of natural productsNHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 14.2)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesNHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 14.2)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingheme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 13.6)
    MetabolismTransport and binding proteinsOtherheme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 13.6)
    gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 13.2)
    Cellular processesCellular processesToxin production and resistanceputative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 13)
    MetabolismTransport and binding proteinsUnknown substrateputative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 13)
    thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 12.3)
    Cellular processesCellular processesCell divisioncell division ATP-binding protein FtsE (TIGR02673; HMM-score: 12.2)
    proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 11.1)
  • TheSEED:  
    Cell Wall and CapsuleGram-Positive cell wall componentsTeichoic and lipoteichoic acids biosynthesis Teichoic acid export ATP-binding protein TagH (EC 3.6.3.40) 
    CBSS-176280.1.peg.1561 Teichoic acid export ATP-binding protein TagH (EC 3.6.3.40) 
  • PFAM:
    P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 27.1)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helix: 1
  • LocateP: Intracellular /TMH start AFTER 60
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: Possibly Sec-
    • Intracellular Possibility: 0.17
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.128
    • Ymax_pos: 19
    • Cmax: 0.138
    • Cmax_pos: 62
    • Smax: 0.203
    • Smax_pos: 10
    • Smean: 0.149
    • D: 0.136
  • predicted transmembrane helices (TMHMM): 1

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MGSSIVLKLLKVTHYYRNKQNKKWYLPFGYDAEDIDLNNISLHIYQGEALGIIGEPESSKALVGQLLAGAIKPDKGKVVCTEDLFYGYIEDQSLIHQTVEAYTAQLVQLFPYEINDHKAEQIIQYAHLGDYKTKPVNHISKAAYAQLLLSIARSSKSNIIILNHVIDYLTPQFMERAIELTNDYIENNLTIVSIGDDIDKISQVSNYIAWFSHGQLRMEGSLKQVIPSFKEHERDRLSLNSKEEIENFDLDWKKNRTRIPEMTYNFKRVERYNHAKPPKFLVRFWTLASGTILGLALMMLLIFNNIGIISITDFTNRATMQNENKDPYGEKLAYGIAFNGSVDMQGDKQVTIPKYSVVTITGENSKNYRVTADNKTYYVSKDKLEYFNPAGLYQTHSFKKLAPYMKSNYSNYYAYFNSQLHKKHSSVIKTLVPDDDNRFVASVTQQPIQLLFNDNNQLYGFVYPIVDKKELKDKFNINNNIWITKVGNGYCIANLKEDKWIYIEL

Experimental data[edit source | edit]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS ONE: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. Kristina Hempel, Jan Pané-Farré, Andreas Otto, Susanne Sievers, Michael Hecker, Dörte Becher
    Quantitative cell surface proteome profiling for SigB-dependent protein expression in the human pathogen Staphylococcus aureus via biotinylation approach.
    J. Proteome Res.: 2010, 9(3);1579-90
    [PubMed:20108986] [WorldCat.org] [DOI] (I p)
  3. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int. J. Med. Microbiol.: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]