NCBI: 10-JUN-2013
Contents
⊟Summary[edit source | edit]
- organism: Staphylococcus aureus COL
- locus tag: SACOL1940 [new locus tag: SACOL_RS10145 ]
- pan locus tag?: SAUPAN004897000
- symbol: SACOL1940
- pan gene symbol?: —
- synonym:
- product: hypothetical protein
⊟Genome View[edit source | edit]
⊟Gene[edit source | edit]
⊟General[edit source | edit]
- type: CDS
- locus tag: SACOL1940 [new locus tag: SACOL_RS10145 ]
- symbol: SACOL1940
- product: hypothetical protein
- replicon: chromosome
- strand: +
- coordinates: 2003055..2003330
- length: 276
- essential: unknown other strains
⊟Accession numbers[edit source | edit]
- Gene ID: 3237511 NCBI
- RefSeq: YP_186765 NCBI
- MicrobesOnline: 913419 MicrobesOnline
⊟Phenotype[edit source | edit]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit source | edit]
- 1
61
121
181
241ATGGAAAATAAATTTGTTCCTGGTATTTTAATTGGTGCCGTAATTGGTGGTGCAATTAGT
TTAGCTGATAAATCTACACGTCAAGCTTTAGTTCAATCAGTTAAAGATGCAAAAAATGGT
AACCGCACTCGTAAGCCTTCTAAAGTCAGCAAGATTAAAGACGAAGTTTTATACTGGAAA
GATGTTGTTGAAGAAATTCGTCGTAATAATCCTGAATTAGAACGTTCATTAAAGGATGCG
AAAGAAACATTTGTTAATAGAAAAAATCAACGCTAA60
120
180
240
276
⊟Protein[edit source | edit]
⊟General[edit source | edit]
- locus tag: SACOL1940 [new locus tag: SACOL_RS10145 ]
- symbol: SACOL1940
- description: hypothetical protein
- length: 91
- theoretical pI: 10.8021
- theoretical MW: 10321.8
- GRAVY: -0.767033
⊟Function[edit source | edit]
⊟Structure, modifications & interactions[edit source | edit]
- domains:
- modifications:
- cofactors:
- effectors:
- protein partners:
⊟Localization[edit source | edit]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 7.5
- Cytoplasmic Membrane Score: 1.15
- Cellwall Score: 0.62
- Extracellular Score: 0.73
- Internal Helices: 0
- LocateP: N-terminally anchored (No CS)
- Prediction by SwissProt Classification: Membrane
- Pathway Prediction: Sec-(SPI)
- Intracellular Possibility: 0.17
- Signal Peptide Possibility: 0
- N-terminally Anchored Score: 7
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- Ymax: 0.257
- Ymax_pos: 30
- Cmax: 0.194
- Cmax_pos: 23
- Smax: 0.57
- Smax_pos: 21
- Smean: 0.296
- D: 0.272
- predicted transmembrane helices (TMHMM): 1
⊟Accession numbers[edit source | edit]
⊟Protein sequence[edit source | edit]
- MENKFVPGILIGAVIGGAISLADKSTRQALVQSVKDAKNGNRTRKPSKVSKIKDEVLYWKDVVEEIRRNNPELERSLKDAKETFVNRKNQR
⊟Experimental data[edit source | edit]
- experimentally validated: PeptideAtlas
⊟Expression & Regulation[edit source | edit]
⊟Operon[edit source | edit]
⊟Regulation[edit source | edit]
- sigma factor:
- regulator:
⊟Transcription pattern[edit source | edit]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit source | edit]
- Aureolib: no data available
⊟Protein stability[edit source | edit]
- half-life: no data available
⊟Biological Material[edit source | edit]
⊟Mutants[edit source | edit]
⊟Expression vector[edit source | edit]
⊟lacZ fusion[edit source | edit]
⊟GFP fusion[edit source | edit]
⊟two-hybrid system[edit source | edit]
⊟FLAG-tag construct[edit source | edit]
⊟Antibody[edit source | edit]
⊟Other Information[edit source | edit]
You are kindly invited to share additional interesting facts.
⊟Literature[edit source | edit]
⊟References[edit source | edit]
- ↑
Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
PLoS ONE: 2009, 4(12);e8176
[PubMed:19997597] [WorldCat.org] [DOI] (I e) - ↑
Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
The Staphylococcus aureus proteome.
Int. J. Med. Microbiol.: 2014, 304(2);110-20
[PubMed:24439828] [WorldCat.org] [DOI] (I p)
⊟Relevant publications[edit source | edit]