From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL2246 [new locus tag: SACOL_RS11815 ]
  • pan locus tag?: SAUPAN005709000
  • symbol: SACOL2246
  • pan gene symbol?: glcU
  • synonym:
  • product: sugar transporter

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL2246 [new locus tag: SACOL_RS11815 ]
  • symbol: SACOL2246
  • product: sugar transporter
  • replicon: chromosome
  • strand: +
  • coordinates: 2313261..2314124
  • length: 864
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    TTGCAATTTCTTGATTTCTTAATCGCACTTTTACCTGCTTTATTCTGGGGAAGTGTCGTT
    CTTATTAATGTGTTCGTCGGCGGTGGACCTTACAACCAAATTCGTGGTACGACGCTAGGC
    GCACTCATTGTTGGATTAGGTTTACTTATTACTGGTTTCGCAAAATTCAATAATCCTACT
    GTAATTATTGTCGGTCTTATTTCTGGTGCATTATGGGCGTTTGGACAAGCGAATCAGCTT
    AAATCTATTAGTTTAATCGGTGTATCAAATACTATGCCAGTTTCTACAGGTATGCAATTA
    GTTGGTACAACATTATTCAGCGTTATCTTTTTAGGTGAATGGTCTTCAATGACTCAAATT
    ATCTTTGGTTTAATCGCCATGATATTATTAGTTACTGGTGTAGCACTTACTTCACTTAAA
    GCTAAAAATGAACGTCAATCAGATAATCCTGAATTTAAAAAAGCAATGGGTATTTTAATT
    GTATCTACAGTTGGATATGTAGGTTTCGTTGTACTTGGTGACATCTTTGGTGTTGGTGGA
    ACTGATGCATTGTTCTTCCAATCTGTCGGTATGGCAATTGGTGGCTTTATCCTATCCATG
    AATCATAAAACATCACTTAAATCAACAGCACTTAATCTATTGCCAGGTGTGATTTGGGGA
    ATTGGTAACTTGTTCATGTTCTATTCTCAACCAAAAGTTGGTGTAGCTACAAGTTTCTCA
    TTATCACAGTTACTTGTTATCGTTTCAACCTTAGGCGGTATTTTCATTTTAGGAGAAAGA
    AAAGATCGTCGTCAGATGACGGGTATTTGGGCAGGTATTATTATTATCGTGATAGCTGCT
    ATAATTCTAGGTAATTTGAAATAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    864

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL2246 [new locus tag: SACOL_RS11815 ]
  • symbol: SACOL2246
  • description: sugar transporter
  • length: 287
  • theoretical pI: 10.52
  • theoretical MW: 30393.1
  • GRAVY: 0.93554

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsRhaT L-rhamnose-proton symporter family protein (TIGR00776; HMM-score: 317)
  • TheSEED:  
    Glucose:proton symporter GlcU 
  • PFAM:
    DMT (CL0184) Sugar_transport; Sugar transport protein (PF06800; HMM-score: 329.9)
    EamA; EamA-like transporter family (PF00892; HMM-score: 24.5)
    Ureide_permease; Ureide permease (PF07168; HMM-score: 21.3)
    GPCR_A (CL0192) Ceramidase; Ceramidase (PF05875; HMM-score: 10.5)
    PepSY_TM-like (CL0490) PepSY_TM_like_2; Putative PepSY_TM-like (PF16357; HMM-score: 9.8)
    DMT (CL0184) TMEM144; Transmembrane family, TMEM144 of transporters (PF07857; HMM-score: 8.2)
    no clan definedPRA1; PRA1 family protein (PF03208; HMM-score: 7.6)
    Thioredoxin (CL0172) OST3_OST6; OST3 / OST6 family, transporter family (PF04756; HMM-score: 5.5)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 10
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 10
  • LocateP: Multi-transmembrane
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular Possibility: 0.17
    • Signal Peptide Possibility: -0.5
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.142
    • Ymax_pos: 11
    • Cmax: 0.174
    • Cmax_pos: 57
    • Smax: 0.279
    • Smax_pos: 2
    • Smean: 0.207
    • D: 0.168
  • predicted transmembrane helices (TMHMM): 9

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MQFLDFLIALLPALFWGSVVLINVFVGGGPYNQIRGTTLGALIVGLGLLITGFAKFNNPTVIIVGLISGALWAFGQANQLKSISLIGVSNTMPVSTGMQLVGTTLFSVIFLGEWSSMTQIIFGLIAMILLVTGVALTSLKAKNERQSDNPEFKKAMGILIVSTVGYVGFVVLGDIFGVGGTDALFFQSVGMAIGGFILSMNHKTSLKSTALNLLPGVIWGIGNLFMFYSQPKVGVATSFSLSQLLVIVSTLGGIFILGERKDRRQMTGIWAGIIIIVIAAIILGNLK

Experimental data[edit source | edit]

  • experimental localization: Integral membrane [1] [2]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS ONE: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int. J. Med. Microbiol.: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]