From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL2424 [new locus tag: SACOL_RS12720 ]
  • pan locus tag?: SAUPAN005963000
  • symbol: bioW
  • pan gene symbol?: bioW
  • synonym:
  • product: 6-carboxyhexanoate--CoA ligase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL2424 [new locus tag: SACOL_RS12720 ]
  • symbol: bioW
  • product: 6-carboxyhexanoate--CoA ligase
  • replicon: chromosome
  • strand: -
  • coordinates: 2482517..2483209
  • length: 693
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    ATGTATAGTATAAAAATGCGTTCTAGCAATCAAGATGTTCATATTAGTGGTGCTGAAACG
    ATTTGTGAGTTTGACAAAATAGAACAGACGGTACAAAGGTTTTATAATAAAGGTTTTTTT
    CATGAAAATGGGCAACCGGATTTTCTCAATATAAAAATACAAAAAATCATGGAACCGATT
    CAACAAATAAAAGCACTACAAATTATTGAGGATGATAAAGCAAATCTCCAACATTTAACA
    CAAGAATGTGGTGTCACTGAACAAGCGCTAAATCAAGGGATGACATATATTAAAAATGAA
    ACGGTTTATACAGGAGCTATTATTCTATCTGCTATATCTGGTAAACGTTTAGATTCATTT
    GGACAAAGGGGGATTAGGGCAACACATTTTTCGTTTGAAGATATAAATAATAAAGGTGAT
    CTTAATGAAAGAGTGACTGATGCCTTAGCAATTGCTAGTTGTATCAATGCGCATCCGTAT
    GTCAAAGGAGAACTTTGCGTGTCCGATGACTTAACGTATACGACAGGTTATTTTGCCGCT
    GCTAAAATTGGTTACCATCGATTATTTGATATTAAACCAGTTAATACGAGATATGGAGGC
    AGAATAATATTTGTGGACGATTGTATTGATTTAAATCATTACATATCATTTTTAGAAAGC
    ACACCGAAGCAAGTTGTTTATGAAACGGTATAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    693

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL2424 [new locus tag: SACOL_RS12720 ]
  • symbol: BioW
  • description: 6-carboxyhexanoate--CoA ligase
  • length: 230
  • theoretical pI: 5.88586
  • theoretical MW: 26091.4
  • GRAVY: -0.29087

Function[edit source | edit]

  • reaction:
    EC 6.2.1.14?  ExPASy
    6-carboxyhexanoate--CoA ligaseATP + 6-carboxyhexanoate + CoA = AMP + diphosphate + 6-carboxyhexanoyl-CoA
  • TIGRFAM:
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersBiotin6-carboxyhexanoate--CoA ligase (TIGR01204; EC 6.2.1.14; HMM-score: 155.1)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersFolic acid2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase (TIGR01498; EC 2.7.6.3; HMM-score: 12.5)
  • TheSEED:  
    Cofactors, Vitamins, Prosthetic Groups, PigmentsBiotinBiotin biosynthesis Pimeloyl-CoA synthase (EC 6.2.1.14) 
  • PFAM:
    no clan definedBioW; 6-carboxyhexanoate--CoA ligase (PF03744; HMM-score: 237.9)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors: Mg2+
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 0
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.126
    • Ymax_pos: 18
    • Cmax: 0.168
    • Cmax_pos: 18
    • Smax: 0.159
    • Smax_pos: 1
    • Smean: 0.099
    • D: 0.115
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MYSIKMRSSNQDVHISGAETICEFDKIEQTVQRFYNKGFFHENGQPDFLNIKIQKIMEPIQQIKALQIIEDDKANLQHLTQECGVTEQALNQGMTYIKNETVYTGAIILSAISGKRLDSFGQRGIRATHFSFEDINNKGDLNERVTDALAIASCINAHPYVKGELCVSDDLTYTTGYFAAAKIGYHRLFDIKPVNTRYGGRIIFVDDCIDLNHYISFLESTPKQVVYETV

Experimental data[edit source | edit]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator: BirA
    BirA (TF) important in Biotin biosynthesis  RegPrecise    transcription unit transferred from N315 data RegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS ONE: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J. Proteome Res.: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]