From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL2533 [new locus tag: SACOL_RS13270 ]
  • pan locus tag?: SAUPAN006167000
  • symbol: SACOL2533
  • pan gene symbol?:
  • synonym:
  • product: glyoxalase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL2533 [new locus tag: SACOL_RS13270 ]
  • symbol: SACOL2533
  • product: glyoxalase
  • replicon: chromosome
  • strand: +
  • coordinates: 2594247..2595053
  • length: 807
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    ATGGCATTTCACGATAAAACAGCAACACAAGTGACAAACATTGTACTGAACGTAAGAGAC
    TTAGACTTAATGACAACATTTTACAAAAACATTTTAGGACTATCCGTTAAAAGTTCTGAC
    GATAATACAACCGTATTATCTGTTGGGACTGGTGGCCATACTCTAACGTTACATTTATTA
    GAAGACGGCCGTCAGACTTCCCCACGTGAAGCAGGGCTTTTTCATATAGCATTTTTATTA
    CCAACTACTGAGGATCTAGCTAACTTCTTATATTTCGTGGCACAAAAAAATATGGGCATC
    GGCGCTGGTGATCATTTAGTAAGTGAAGCTTTATATTTCAACGACCCCGAAGGTAATGGT
    ATTGAAGTCTATCGCGATAGACCTTCATCTTCATGGGAATGGCAAAATGGCAAAGTTAAA
    ATGGATACTTTAGAAGTTGATAGCCAAACCTTATTAACACATCGTACTGATGAAGGTTGG
    CAAGGAATGCCAGCAAAAGGCATGATTGGACACTTACATTTAAAAACACATGATTTAGAC
    GCAGCATATCAATGTTACATTGAACAATTAGGATTCCAACATGTGTCTGATTTTCCACGT
    GCGCTATTTATGTCAACGAATCATTATCACCATCATATTGCTGCTAATACTTGGCAATCC
    AATCAAGCAAGACAAAACAATTCACAAAGTTATGGATTAACACATGTTGATATTTATCAA
    CCCGACGCCTCAACACATACATTTACGGCACCAGAAGGGTTTGACATCACAGTTCATTCA
    AATACTGACCTTGTTCCAGAAAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    807

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL2533 [new locus tag: SACOL_RS13270 ]
  • symbol: SACOL2533
  • description: glyoxalase
  • length: 268
  • theoretical pI: 5.74646
  • theoretical MW: 30059.2
  • GRAVY: -0.438433

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    3,4-dihydroxyphenylacetate 2,3-dioxygenase (TIGR02295; EC 1.13.11.15; HMM-score: 45.6)
    MetabolismEnergy metabolismOthercatechol 2,3 dioxygenase (TIGR03211; EC 1.13.11.2; HMM-score: 41.1)
    MetabolismEnergy metabolismOther2,3-dihydroxybiphenyl 1,2-dioxygenase (TIGR03213; EC 1.13.11.39; HMM-score: 27.5)
    methylmalonyl-CoA epimerase (TIGR03081; EC 5.1.99.1; HMM-score: 17.1)
    MetabolismEnergy metabolismOtherlactoylglutathione lyase (TIGR00068; EC 4.4.1.5; HMM-score: 15.4)
    MetabolismCentral intermediary metabolismAmino sugarslactoylglutathione lyase (TIGR00068; EC 4.4.1.5; HMM-score: 15.4)
  • TheSEED:  
    CarbohydratesOne-carbon MetabolismSerine-glyoxylate cycle Glyoxalase family protein 
  • PFAM:
    Glyoxalase (CL0104) Glyoxalase; Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily (PF00903; HMM-score: 63.8)
    CppA_N; CppA N-terminal (PF14506; HMM-score: 14.4)
    Glyoxalase_3; Glyoxalase-like domain (PF13468; HMM-score: 12.7)
    Glyoxalase_2; Glyoxalase-like domain (PF12681; HMM-score: 12)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.133
    • Ymax_pos: 40
    • Cmax: 0.116
    • Cmax_pos: 40
    • Smax: 0.226
    • Smax_pos: 36
    • Smean: 0.108
    • D: 0.123
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MAFHDKTATQVTNIVLNVRDLDLMTTFYKNILGLSVKSSDDNTTVLSVGTGGHTLTLHLLEDGRQTSPREAGLFHIAFLLPTTEDLANFLYFVAQKNMGIGAGDHLVSEALYFNDPEGNGIEVYRDRPSSSWEWQNGKVKMDTLEVDSQTLLTHRTDEGWQGMPAKGMIGHLHLKTHDLDAAYQCYIEQLGFQHVSDFPRALFMSTNHYHHHIAANTWQSNQARQNNSQSYGLTHVDIYQPDASTHTFTAPEGFDITVHSNTDLVPEK

Experimental data[edit source | edit]

  • experimentally validated: PeptideAtlas
    experimental localization: Cytoplasmic [1] [2]
    quantitative data / protein copy number per cell: 37 [3]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS ONE: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int. J. Med. Microbiol.: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)
  3. Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
    Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
    Sci Rep: 2016, 6;28172
    [PubMed:27344979] [WorldCat.org] [DOI] (I e)

Relevant publications[edit source | edit]