From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL2554 [new locus tag: SACOL_RS13370 ]
  • pan locus tag?: SAUPAN006197000
  • symbol: SACOL2554
  • pan gene symbol?: cidB
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL2554 [new locus tag: SACOL_RS13370 ]
  • symbol: SACOL2554
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 2613124..2613813
  • length: 690
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    ATGAATGATTACGTGCAAGCCTTATTAATGATTTTGTTGACTGTCGTTTTATATTATTTC
    GCTAAAAGGTTACAACAAAAATATCCGAACCCATTTTTGAATCCAGCATTAATTGCATCT
    TTAGGAATTATTTTTGTCTTACTTATCTTTGGAATTAGTTATAACGGGTATATGAAAGGT
    GGCAGTTGGATCAACCATATTTTAAACGCAACGGTCGTATGTTTAGCGTACCCACTTTAT
    AAAAATAGAGAGAAAATTAAAGACAATGTCTCTATCATTTTTGCAAGTGTATTAACTGGC
    GTCATGCTGAATTTCATGTTAGTGTTCTTAACACTTAAAGCATTTGGCTATTCTAAAGAC
    GTCATTGTAACGTTATTGCCCCGATCTATAACAGCCGCAGTAGGTATCGAAGTGTCACAT
    GAACTAGGTGGTACAGATACGATGACCGTACTTTTTATTATCACAACGGGTTTAATCGGT
    AGTATTTTAGGTTCGATGTTATTAAGATTTGGAAGATTTGAATCTTCTATCGCCAAAGGA
    TTAACGTATGGGAATGCGTCACATGCATTTGGCACAGCTAAAGCACTAGAAATGGATATT
    GAATCCGGTGCATTTAGTTCAATTGGGATGATTTTAACTGCAGTTATTAGTTCAGTGTTA
    ATACCTGTTCTAATTTTATTATTCTATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    690

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL2554 [new locus tag: SACOL_RS13370 ]
  • symbol: SACOL2554
  • description: hypothetical protein
  • length: 229
  • theoretical pI: 9.40732
  • theoretical MW: 25011.7
  • GRAVY: 0.851528

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Hypothetical proteinsConservedTIGR00659 family protein (TIGR00659; HMM-score: 192.1)
  • TheSEED:  
    Regulation and Cell signalingProgrammed Cell Death and Toxin-antitoxin SystemsMurein hydrolase regulation and cell death CidA-associated membrane protein CidB 
  • PFAM:
    no clan definedLrgB; LrgB-like family (PF04172; HMM-score: 232.6)
    RETICULATA-like; Protein RETICULATA-related (PF11891; HMM-score: 12.8)
    DUF3290; Protein of unknown function (DUF3290) (PF11694; HMM-score: 10.7)
    Thioredoxin (CL0172) OST3_OST6; OST3 / OST6 family, transporter family (PF04756; HMM-score: 7.6)
    no clan definedDUF3671; Protein of unknown function (PF12420; HMM-score: 7.3)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 10
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 6
  • LocateP: Multi-transmembrane
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular Possibility: 0.17
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.115
    • Ymax_pos: 27
    • Cmax: 0.139
    • Cmax_pos: 22
    • Smax: 0.21
    • Smax_pos: 1
    • Smean: 0.096
    • D: 0.108
  • predicted transmembrane helices (TMHMM): 6

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MNDYVQALLMILLTVVLYYFAKRLQQKYPNPFLNPALIASLGIIFVLLIFGISYNGYMKGGSWINHILNATVVCLAYPLYKNREKIKDNVSIIFASVLTGVMLNFMLVFLTLKAFGYSKDVIVTLLPRSITAAVGIEVSHELGGTDTMTVLFIITTGLIGSILGSMLLRFGRFESSIAKGLTYGNASHAFGTAKALEMDIESGAFSSIGMILTAVISSVLIPVLILLFY

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor: RpoF (SigB*) [1] [2] other strains
    RpoF  (SigB*) (sigma factor) controls a large regulon involved in stress/starvation response and adaptation
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]